The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.

A. Ribosomal subunits

B. A start codon

C. DNA polymerase enzyme

D. General transcription factors

E. RNA polymerase enzyme

Solutions

Expert Solution

Answer: Option D &E [ General transcription factor & RNA polymerase enzyme]

The initiation of transcription in eukaryotic cells took place in a particular way. In starting an RNA polymerase along with general transcription factor (is a group of specific proteins which are involved in transcription initiation and regulation) bind to the promoter region of the gene which forms the preinitiation complex, which is a closed complex. After that this closed complex changes into the open complex which cause the denaturation or separation of two DNA strands and positioning the template strand towards the active site of RNA polymerase. In this case, RNA polymerase didn’t need any primer and the initiation of the new RNA chain using template DNA strand as a guide for exact ribonucleotide selection and polymerization took place.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box;...

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box; Conserved & variable regions in promoters. Eukaryotic enhancers. Why is it important that there are multiple control elements in a single enhancer? What binds to the control elements? How is it possible for a small number of activator and transcription factor proteins to regulate a large number of genes? Transcription: Elongation & RNA polymerase. RNA polymerase vs. DNA polymerase. Termination. MyoD: What makes it...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...

In eukaryotic promoter recognition, the multi-subunit protein ___________ recognizes and binds to the

In eukaryotic promoter recognition, the multi-subunit protein ___________ recognizes and binds to the ___________ ___________ consensus sequence, and recruits RNA polymerase II to initiate transcription. In prokaryotic promoter recognition, consensus sequences at the ___________ and ___________ positions are recognized by the ___________ ___________, which is complexed with the RNA polymerase core enzyme.

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially...

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially used in the identification of promoter sequences was ________________. A more contemporary technique for identification of promoter sequences is the _________ _____________________ assay.

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How and why do consensus sequences differ from one another?

Briefly explain what will happen to the transcription of a gene, if its core promoter elements...

Briefly explain what will happen to the transcription of a gene, if its core promoter elements (Class II promoter with 3 elements: BRE, TATA and Inr) are moved downstream to the TSS (transcription site)? Explain why eukaryotic cells have general and specific transcription factors?

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal...

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal promoter elements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw a full-length primary transcript of the gene with the 5’ and 3’ ends labeled, and below that draw the final mature mRNA with the ends and coding sequence labeled. Be sure it is clear which parts of the gene are represented in the primary...

I discovered a new transcription activator (a protein that binds a specific DNA sequence at promoters...

I discovered a new transcription activator (a protein that binds a specific DNA sequence at promoters of genes) and helps bring in the SWI/SNF complex to the promoters of 200 genes. What would be the affect on chromatin organization and gene expression at these genes if I mutate the transcription activator such that it no longer is able to bind DNA?

1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of...

1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of a diagram, briefly discuss this statement. b) Provide an example of how combinatorial regulation of gene expression is involved in the development of higher organisms.

Subjects