summarize the process of RNAP binding to the promoter during transcription.

Expert Solution

Transcription is process of RNA synthesis on DNA template . This process carried out by RNA polymerase. RNA polymerase (RNAP) initiate transcription by recognition and binding to the promoter. Promoter have consensus segment upon which RNA polymerase bind.

( Consensus segment/sequence= -10 and -35 sequence in bacteria , CAAT box and TATA box in eukaryotes promoter)

Explanation :

gladiator answered 2 years ago

what are the roles of transcription factors and the promoter reguon in transcription?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme

A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...

A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding region, and untranslated regions. Below the gene draw a full-length mRNA transcript of the gene. On the mRNA, label the 5’ & 3’ ends, the coding region, and the UTRs. B. Draw a typical eukaryotic gene. Be sure to includeand labelthe core promoter, some proximal promoterelements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw...

1a. The term “transcription factor binding site” (aka TF binding site) refers to __

1a. The term “transcription factor binding site” (aka TF binding site) refers to __1b. Transcription factor binding sites are often found where within genomic DNA?1c. Transcription factor binding sites could be referred to as cis-acting elements because __1d. Transcription factors (both activators and repressors) could also be referred to as trans-acting factors because __ Terms Lac operon Operator Repressor protein CAP (catabolite activator protein) Trans acting factors vs. Cis acting elements Transcription factor Transcriptional activator vs. repressor DNA-binding domain Transcription factor binding site Activation vs. Repression domains Chromatin Nucleosome 10nm- vs. 30nm-fibers Euchromatin vs. heterochromatin Histones...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box;...

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box; Conserved & variable regions in promoters. Eukaryotic enhancers. Why is it important that there are multiple control elements in a single enhancer? What binds to the control elements? How is it possible for a small number of activator and transcription factor proteins to regulate a large number of genes? Transcription: Elongation & RNA polymerase. RNA polymerase vs. DNA polymerase. Termination. MyoD: What makes it...

Discuss what you understand by the term 'promoter' in the context of transcription? (500 words)

Briefly explain what will happen to the transcription of a gene, if its core promoter elements...

Briefly explain what will happen to the transcription of a gene, if its core promoter elements (Class II promoter with 3 elements: BRE, TATA and Inr) are moved downstream to the TSS (transcription site)? Explain why eukaryotic cells have general and specific transcription factors?

Transcription factors are __________. Select one: a. regulatory bases that bind to the promoter b. none...

Transcription factors are __________. Select one: a. regulatory bases that bind to the promoter b. none of these c. regulatory proteins that bind to a promoter site d. regulatory sequences that bind to a protein e. regulatory DNA sequences that bind to the promoter site

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How and why do consensus sequences differ from one another?

Question