Question

In: Biology

Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence...

Briefly explain how a transcription factor located 10,000 nucleotides upstream of the promoter sequence can influence gene expression.

Solutions

Expert Solution

ANSWER :-

Transcription factor as we know aretproteins that bind DNA and regulate the process of transcription( DNA --> mRNA), by binding to a specific DNA sequence. In simple term, the transcription factor regulate the gene expression by promoting and suppressing the transciption. The transcription factors binds to either enhancer or promoter regions of DNA that are present adjacent to the genes that they regulate. Depending on the transcription factor , the transcription of the adjacent gene is either up-regulated or down -regulated. upstream is towards the 5' end of the RNA molecule.

when the transcription factor located 10,000 nucleotides upstream of the promoter sequence it influences the gene expression by binding with the promoter, it increases the gene transcription.The transcription factor or RNA polymerase binds to the binds to promoter or activator, the activator helps general transcription factor or RNA polymerase to assemble to begin the transcription. all these mechanism takes place on the target gene. The binding sites for the transcription factors are often close to a genes promoter. However, they are also found on the other parts of DNA , sometimnes very far away from the promoter like 10,000 nucleotide away upstrem, and still affect the transcription of gene. in such cases, the flexibility of DNA that allow transcription factor at distant binding sites to do their job. The DNA looped to bring far-off binding sited and transcription factors close to general transcription factors or proteins.


Related Solutions

How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How...
How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? How and why do consensus sequences differ from one another?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
Briefly explain what will happen to the transcription of a gene, if its core promoter elements...
Briefly explain what will happen to the transcription of a gene, if its core promoter elements (Class II promoter with 3 elements: BRE, TATA and Inr) are moved downstream to the TSS (transcription site)? Explain why eukaryotic cells have general and specific transcription factors?
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...
The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?
A(n) _____ is located upstream of a gene's coding region. a. promoter b. start codon c....
A(n) _____ is located upstream of a gene's coding region. a. promoter b. start codon c. origin of replication d. 3' UTR e. stop codon Transcription results in the production of (select all that apply): a. rRNA b. RNA polymerase c. tRNA d. mRNA e. polypeptides f. enzymes g. DNA h. Okazaki fragments
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence,...
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence, CAG, important in Huntington Disease?
Describe the allosteric regulation model for transcription termination and briefly indicate how this model can explain...
Describe the allosteric regulation model for transcription termination and briefly indicate how this model can explain both Rho dependent and Rho independent termination reactions.
Identify and briefly explain any three factor which influence interest rates set by commercial banks
Identify and briefly explain any three factor which influence interest rates set by commercial banks
Briefly elaborate on the major domains of a specific transcription factor necessary to transmit information from...
Briefly elaborate on the major domains of a specific transcription factor necessary to transmit information from the enhancer to the promoter element.
1. Explain prokaryotic transcription initiation from promoter recognition to transcript elongation. Include the role of the...
1. Explain prokaryotic transcription initiation from promoter recognition to transcript elongation. Include the role of the different regions of the sigma factor in formation of the open complex. Explain what strong and weak promoters mean and what determines whether a promoter is strong or weak. Also explain what abortive synthesis is, why it occurs and what has to happen for promoter escape to occur. 2. Explain how the lac operon is turned on/off. What conditions lead to repressor binding, what...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT