5) A mutation in E. coli designated polA1 was discovered that is deficient in DNA polyermase...

5) A mutation in E. coli designated polA1 was discovered that is deficient in DNA polyermase I activity Because of this, researchers hypothesized that DNA duplication may not be successful. Is their hypothesis true? If it was not, why? In what other way could this strain be deficient?

Expert Solution

The hypothesis is false. This is because DNA polymerase I in E. coli exhibits functions like follows:

DNA pol I acts as a 5'?3' DNA-Dependent DNA polymerase activity that requires a 3' primer site and a template strand. DNA pol I also exhibits 3'?5' exonuclease activity or proofreading. It is also involved in 5'?3' exonuclease activity mediating nick translation during DNA repair. DNA polymerase I acts as a 5'?3' RNA-dependent DNA polymerase activity. The efficiency of Pol I on RNA templates is low and is about only 0.1–0.4% which is less than its efficiency on DNA templates.

Though multiple functions are carried out by DNA polymerase I, the actual function of it was discovered by an experiment creating mutation in deficient Pol I mutant strain of E. coli. The mutant strain was isolated and treated with a mutagen. These mutant E. coli strains that lack Pol I enzyme formed colonies. By this it was evident that DNA pol I is not required DNA replication. Moreover, the mutant strains lacking pol I exhibited extreme sensitivity to DNA damage by UV light. By this it is evident that, DNA polymerase I is mostly involved in DNA repair mechanism rather than in DNA replication.

gladiator answered 1 year ago

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA polymerase II __________________________________________________ DNA polymerase III _________________________________________________ DNA polymerase IV _________________________________________________ DNA polymerase V _________________________________________________ Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

What would be the predicted phenotype of an E. coli mutant that contains a mutation in...

What would be the predicted phenotype of an E. coli mutant that contains a mutation in the cheA gene that abolishes its autophosphorylation activity? State the predicted phenotype. What kind of motility would it display?

A strain of E. coli carries a mutation that completely inactivates the enzyme encoded in the...

A strain of E. coli carries a mutation that completely inactivates the enzyme encoded in the gene. Several revertants, mutants of the mutant with partly or fully restored activity, were selected, and the amino acid sequence of the enzyme was determined. The only differences found were at position 10 in the polypeptide chain. Revertant 1 had Thr. Revertant 2 had Glu. Revertant 3 had Met. Revertant 4 had Arg. Assume that the initial mutation itself, as well as each revertant,...

Explain how an E. coli cell that is deficient for proline synthesis (pro-) could become pro+...

Explain how an E. coli cell that is deficient for proline synthesis (pro-) could become pro+ through the process of transduction.

Question 1. A strain of E. coli carries a substitution mutation causing the terminator codon 5’-UAG-3’...

Question 1. A strain of E. coli carries a substitution mutation causing the terminator codon 5’-UAG-3’ to occur at an interior position in a particular type of mRNA. This strain also carries a suppressor mutation that alters the anti-codon of a type of tRNA molecule so that it reads 3’-AUC-5’. This type of tRNA reads this terminator codon and inserts the amino acid tyrosine. a.What effect would the presence of both of these mutations together have on the polypeptide translated...

Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA...

Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA pols in eukaryotes. Be detailed about how they initiate replication, how they carry out it, what is the error rate, and any other differences they might have. Which ones are used in the lab?

Operon. A particular E. Coli strain has a mutation in the operator of the tryptophan operon....

Operon. A particular E. Coli strain has a mutation in the operator of the tryptophan operon. How would you expect it would affect the functioning of the operon and the metabolism of the cells? What would happen if the trp operon had a mutation in the: 1. Promoter region? 2. Repressor gene (domain binding to tryptophan)? 3. Leader sequence TGGTGG? 4. Region 3 of Leader mRNA?

Consider a colony of E. coli cells that have a mutation in the lac I gene,...

Consider a colony of E. coli cells that have a mutation in the lac I gene, resulting in a LacR protein that cannot bind to allolactose. Describe the effect that this mutation will have on the lac operon in terms of βgal protein levels when the cells are grown in media containing lactose but no glucose. Explain your reasoning.

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What is the differentiating steps during the DNA isolation so that your target DNA is not contaminated with the other unwanted DNA (i.e. you are targeting extrachromosomal DNA, so you don’t want the genomic DNA, and vice-versa)? Why and how that step can differentiate between these groups of DNA

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

Question