What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli?
1. DNA polymerase I __________________________________________________
2. DNA polymerase II __________________________________________________
3. DNA polymerase III _________________________________________________
4. DNA polymerase IV _________________________________________________
5. DNA polymerase V _________________________________________________

Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

Expert Solution

Question

a. The function of DNA polymerase I

Help to repair any damage in the DNA and connect okazaki fragments present on lagging strand of DNA.

b. The function of DNA polymerase II

Help in repairing of damage DNA

c. The function of DNA polymerase III

Mainly involved in the replication of DNA in 5'->3' direction and involved too in 3'->5' exonucleotic editing of mispaired DNA.

d. The function of DNA IV

It is involved in the non-targeted mutagenesis

e. The function of DNA V

It is involved in the DNA repair mechanism in prokaryotes.

The evolutionary history of these polymerase is still unclear in case of prokaryotes. But it is thought that DNA polymerase III was the first enzyme to evolve as it perform both replication and repair mechanism. We can eliminate DNA polymerase I and DNA polymerase IV but still could have preserved the function. The consequence will be that bacteria DNA would have high risk of mutation . The environment that would be best to grow for this mutant bacteria would be the media with proper nutrient and favorable environment conditions.

gladiator answered 2 years ago

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The...

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The DNA replication is bidirectional; one polymerase is used for each direction. b. Each polymerase is specific for only one strand of DNA. DNA polymerase III acts only on the leading strand, and DNA polymerase I acts only on the lagging strand. c. Only DNA polymerase I has proofreading ability. d. DNA polymerase III lacks the 5' → 3' exonuclease activity needed to remove RNA...

You do a series of incubations to compare the properties of E. coli DNA polymerase I...

You do a series of incubations to compare the properties of E. coli DNA polymerase I and III. After incubating DNA template prepared from bacteriophage T7 with one or the other polymerase for 20 min, you add an excess of a second template, phage T3 DNA and continue the reaction for a further 40 min. You compare the amounts of T3 synthesized to the amount of T7. Most of the DNA synthesized in the polymerase I incubations is found to...

What is the difference between the enzymes DNA polymerase I and ligase? Select one: a. DNA...

What is the difference between the enzymes DNA polymerase I and ligase? Select one: a. DNA polymerase I binds to Okazaki fragments, removes the primers, and replaces them with DNA nucleotides. b. Ligase binds to Okazaki fragments, removes the primers, and replaces them with DNA nucleotides. c. DNA polymerase I attaches the fragments to make one single continuous strand. d. Ligase attaches the Okazaki fragments to make one single continuous strand. e. Both A and D are correct. f. Both...

The β (beta) subunit of E. coli DNA polymerase III possesses which of the following enzymatic...

The β (beta) subunit of E. coli DNA polymerase III possesses which of the following enzymatic activities? 1. 3’- 5’ polymerase 2. 3’- 5’ exonuclease 3. 5’ - 3’ exonuclease 4. 5’ - 3’ polymerase 5. the beta subunit is not an enzyme

Describe the roles of the following enzymes in DNA replication: DNA polymerase, Helicase, Ligase, Primase.

The enzyme required for transcription is * RNA polymerase Restriction enzymes Splicesome DNA polymerase

1. E. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V...

1. E. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V tends to incorporate G rather than A opposite the dam-aged T bases. Would you expect Pol V to be more or less processive than Pol III? Explain. 2. Explain why base excision repair, nucleotide excision repair, and mismatch repair—which all require nucleases to excise damaged DNA—require DNA ligase. 3. Why are there no Pol I mutants that completely lack 5′ → 3′ exo-nuclease activity?

For each of the enzymes listed, write down the information requested: DNA-dependent DNA polymerase Type of...

For each of the enzymes listed, write down the information requested: DNA-dependent DNA polymerase Type of nucleic acid template: Type of nucleic acid produced: When is enzyme used? Eukaryotic, Prokaryotic and DNA virus DNA replication DNA-dependent RNA polymerase Type of nucleic acid template: Type of nucleic acid produced: When is enzyme used? Eukaryotic, Prokaryotic and DNA virus transcription RNA-dependent RNA polymerase Type of nucleic acid template: Type of nucleic acid produced: When is enzyme used? RNA virus replication Alternative name...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What is the differentiating steps during the DNA isolation so that your target DNA is not contaminated with the other unwanted DNA (i.e. you are targeting extrachromosomal DNA, so you don’t want the genomic DNA, and vice-versa)? Why and how that step can differentiate between these groups of DNA