. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What is the differentiating steps during the DNA isolation so that your target DNA is not contaminated with the other unwanted DNA (i.e. you are targeting extrachromosomal DNA, so you don’t want the genomic DNA, and vice-versa)? Why and how that step can differentiate between these groups of DNA

Expert Solution

At the time of separating extrachromosomal DNA from that of genomic DNA it should be kept in mind that chromosomal DNA is thicker than genomic DNA. The separation between the two must be based on size, and by using the correct lysis method. Chromosomal DNA can be separated using alkaline lysis method. The lysis buffer consists of sodium hydroxide and SDS which denatures the plasmid and genomic DNA. This helps in separating the DNA to single strands. Then the sample must be neutralized by the help of potassium acetate to renature the plasmid. This helps in separating plasmid DNMA to that of genomic DNA. As plasmids are small they can reanneal to form double stranded DNA. On the other hand, genomic DNA are too large and thus, they cannot reanneal and remain separated. Thus, after centrifugation genomic DNA form a pellet whereas extrachromosomal DNA remains soluble. This step will help in separating the two types of DNA preventing any contamination.

gladiator answered 1 year ago

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA polymerase II __________________________________________________ DNA polymerase III _________________________________________________ DNA polymerase IV _________________________________________________ DNA polymerase V _________________________________________________ Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

To study the molecular mechanism of DNA replication, you incubated soluble E. coli extracts with a...

To study the molecular mechanism of DNA replication, you incubated soluble E. coli extracts with a mixture of dATP, dTTP, dGTP, and dCTP, all of which are labeled with the α-phosphate group. After a while, the incubation mixture was treated with trichloroacetic acid, which precipitate the DNA but not the nucleotide or very short oligonucleotides. The precipitate was collected and the extent of the radioactively label nucleotide incorporation into the DNA was determined. a. Would this assay identify DNA? Explain....

You do a series of incubations to compare the properties of E. coli DNA polymerase I...

You do a series of incubations to compare the properties of E. coli DNA polymerase I and III. After incubating DNA template prepared from bacteriophage T7 with one or the other polymerase for 20 min, you add an excess of a second template, phage T3 DNA and continue the reaction for a further 40 min. You compare the amounts of T3 synthesized to the amount of T7. Most of the DNA synthesized in the polymerase I incubations is found to...

Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA...

Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA pols in eukaryotes. Be detailed about how they initiate replication, how they carry out it, what is the error rate, and any other differences they might have. Which ones are used in the lab?

You have constructed four different libraries: a genomic library made from DNA isolated from human brain...

You have constructed four different libraries: a genomic library made from DNA isolated from human brain tissue, a genomic library made from DNA isolated from human muscle tissue, a human brain cDNA library, and a human muscle cDNA library. You wish to clone the human gene encoding myostatin, which is expressed only in muscle cells. A. Assuming the human genome is 3×10^9 bp and that the average insert size in the genomic libraries is 100 kb, how frequently will a...

1. In an experiment, you grow E. coli cells in the lab at different temperatures. After...

1. In an experiment, you grow E. coli cells in the lab at different temperatures. After the growth, you isolate their cell membranes, perform complete hydrolysis of their cell membranes and isolate and quantify the percentages of different fatty acids in your final sample. How would you expect the fraction of myristic acid to change as you increase the temperature? 2. Succinyl-CoA is a negative regulator of α-ketoglutarate-dehydrogenase complex. Explain why this makes sense, and propose a possible mechanism for...

How the DNA was extracted from the strawberries, what was the purpose of the soap and...

How the DNA was extracted from the strawberries, what was the purpose of the soap and salt?

separation processes for bioproducts from E. coli . Recombinant protein production from E. coli resulted in...

separation processes for bioproducts from E. coli . Recombinant protein production from E. coli resulted in the first products from biotechnology. (a) List the primary structures and components of E. coli that must be removed from a fermentation broth to purify a heterologous protein product (one that differs from any protein normally found in the organism in question) expressed for pharmaceutical use. (b) Identify a sequence of steps to purify a conjugate heterologous protein (a compound comprised of a protein...

E. coli DNA ligase is different than eukaryotic and bacteriophage DNA ligase. Describe how the reactions...

E. coli DNA ligase is different than eukaryotic and bacteriophage DNA ligase. Describe how the reactions would be different and any other differences in these enzymes that could affect their use in the lab? Which ones are used in the lab and for what?

Question