Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA...

Differentiate between the 3 DNA pols of E. coli (prokaryotic) and the three types of DNA pols in eukaryotes. Be detailed about how they initiate replication, how they carry out it, what is the error rate, and any other differences they might have. Which ones are used in the lab?

Expert Solution

DNA polymerase in e.coli that is prokaryotes are DNA polymerase 1,2,3 . Where as in eukaryotes alpha,beta and gamma .

During replication of prokaryotes DNA polymerase 3 is used .where as in eukaryotes the alpha and delta is used.DNA polymerase 3 will attach to the DNA and initiate and undergoes replication with the help of primers.where as alpha polymerase helps in intiation of replication and lagging strand synthesis and leading strand synthesis takes place by Delta polymerase. Where alpha donot contain proof reading activity also which is carried by delta unit .The three DNA polymerase in prokaryotes have proof reading activity.Where DNA polymerase 1 helps in removal of RNA in after the replication and fill the nucleotide in that region ,whereas in eukaryotes it is carried by RNase enzyme.where DNA polymerase 2 helps in repairing the errors majorly caused during replication where as beta is used in this case.

The prokaryotes contains single chromosome with one origin so that there is high chance of replication error because the DNA polymerase is capable of adding upto 1000 base pairs at a time in replication .where as in eukaryotes they contain many chromosomes many origins .so there is a less chance of error.

The DNA pol 3 is used in lab for prokaryotes where as alpha and delta in eukaryotes .

gladiator answered 1 year ago

There are three (3) types of RNA in prokaryotic cells. What are the types and how...

There are three (3) types of RNA in prokaryotic cells. What are the types and how are these molecules synthesized? Compare and contrast RNA synthesis in prokaryotes to that of eukaryotes.

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA polymerase II __________________________________________________ DNA polymerase III _________________________________________________ DNA polymerase IV _________________________________________________ DNA polymerase V _________________________________________________ Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

Differentiate between the three main types of audits and auditors.

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What is the differentiating steps during the DNA isolation so that your target DNA is not contaminated with the other unwanted DNA (i.e. you are targeting extrachromosomal DNA, so you don’t want the genomic DNA, and vice-versa)? Why and how that step can differentiate between these groups of DNA

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

E. coli DNA ligase is different than eukaryotic and bacteriophage DNA ligase. Describe how the reactions...

E. coli DNA ligase is different than eukaryotic and bacteriophage DNA ligase. Describe how the reactions would be different and any other differences in these enzymes that could affect their use in the lab? Which ones are used in the lab and for what?

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The...

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The DNA replication is bidirectional; one polymerase is used for each direction. b. Each polymerase is specific for only one strand of DNA. DNA polymerase III acts only on the leading strand, and DNA polymerase I acts only on the lagging strand. c. Only DNA polymerase I has proofreading ability. d. DNA polymerase III lacks the 5' → 3' exonuclease activity needed to remove RNA...

5) A mutation in E. coli designated polA1 was discovered that is deficient in DNA polyermase...

5) A mutation in E. coli designated polA1 was discovered that is deficient in DNA polyermase I activity Because of this, researchers hypothesized that DNA duplication may not be successful. Is their hypothesis true? If it was not, why? In what other way could this strain be deficient?

To study the molecular mechanism of DNA replication, you incubated soluble E. coli extracts with a...

To study the molecular mechanism of DNA replication, you incubated soluble E. coli extracts with a mixture of dATP, dTTP, dGTP, and dCTP, all of which are labeled with the α-phosphate group. After a while, the incubation mixture was treated with trichloroacetic acid, which precipitate the DNA but not the nucleotide or very short oligonucleotides. The precipitate was collected and the extent of the radioactively label nucleotide incorporation into the DNA was determined. a. Would this assay identify DNA? Explain....

The diagram below represents the DNA loci of the lac operon in E. coli. Explain the function...

The diagram below represents the DNA loci of the lac operon in E. coli. Explain the function of each of the loci in the space provided. Include if the locus is a cis element or a coding region. If a coding region, include what the coding region produces and the protein’s function. If the locus binds a trans-acting factor, include this as well and the function of the binding. Y CAP locus Lac P locus Lac Z locus Lac Y locus Lac A...

Question