Question

In: Biology

1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of...

1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of a diagram, briefly discuss this statement. b) Provide an example of how combinatorial regulation of gene expression is involved in the development of higher organisms.

Solutions

Expert Solution

Answer: Combination of proteins are responsible for the regulation of gene expression and development in higher organisms. There are both activators and repressors in the cell that control gene expressions. The genome (DNA) is common in all types of cell, while the expression is different in different cells. This makes cell of diverse structure and function. For example, the nerve cells have the same genome as that of blood cell, but their structure and function are a lot different. The differential gene expression is controlled by transcription factors (TFs). But the number of TFs is lesser than the genes they control for expression. That means a different combination of factors regulates gene expression. These combinations can activate or repress genes.

Figure 1 Combination of transcrition factors (TFs; activator) and repressor controlling gene expression in eukaryotes.

Figure (1) shows the three conditions for control of gene expression in eukaryotes. In cell type 1, there is a higher level of gene expression due to the presence of two different TF that binds to different operator present in the upstream region of the mRNA. While the binding of only one of the two TFs in cell type 2 causes a low level of transcription. In cell type 3, the binding of repressor protein leads to no transcription of the given gene. So, the control of gene expression is combinational. These differential levels of gene expression provide different phenotypes to cells.

For the development of a eukaryotic organism, the gene expression is different in both place and time. Specific development occurs at a specific time of growth. The development could be in a specific tissue or organ. Combination of factors secreted in paracrine signalling pathways determines the gene expression in eukaryotes.   


Related Solutions

1.) Explain how combinatorial control makes it possible to have far fewer transcription factors than the...
1.) Explain how combinatorial control makes it possible to have far fewer transcription factors than the number of genes that are transcriptionally regulated. 2.) If a miRNA were 5 nucleotides long, what is the chance of finding a complementary sequence in a randomly selected 5 nucleotide sequence in mRNA? [Assume mRNA sequences to be random and that mRNAs have an equal amount of each nucleotide (A, U, G, and C)]. If an miRNA were 10 nucleotides long, what is the...
Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may...
Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may be altered. How do these alterations induce cancer-causing mutations in cell DNA? Explain how cancer is formed. Describe genetic changes found in cancer cells and how these changes lead to alterations in cell behavior. Determine whether proteome data can be utilized in genetic disorder diagnosis. Relate the Human Genome Project data to the analysis of cancer genes.
Eukaryotic Transcription Factors (TF) can be described as:
Eukaryotic Transcription Factors (TF) can be described as:a. Activators that recruit co-activators to initiate transcription of the geneb. cis-acting transcriptional elementsc. proteins that interact with the promoter/enhancer regions via DNA binding domainsd. multimeric components of nucleosomes
In combinatorial transcriptional regulation, expression of a particular gene in a specific cell type is controlled...
In combinatorial transcriptional regulation, expression of a particular gene in a specific cell type is controlled by Select one: a. the combination of enhancers present in that cell type. b. the combination of transcription factors present in that cell type. c. the requirement of the gene for the cell’s function. d. the presence or absence of RNA polymerase in the cell. In eukaryotic genes, enhancer sequences are usually found Select one: a. close to the promoter region of the gene....
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
Fill in the blank- During eukaryotic transcription, the assembly of the general transcription factors begins with...
Fill in the blank- During eukaryotic transcription, the assembly of the general transcription factors begins with the binding of the factor________in a complex with the general transcription factor_________to DNA, causing a marked local distortion in the double helix. This factor binds at the DNA sequence called the________box, which is typically located 25 nucleotides upstream from the transcription start site. Once RNA polymerase II has been brought to the promoter DNA, it must be released to begin making transcripts. This release...
“Coupled transcription-translation” means _, and the coupling contributes to gene expression regulation via ___. A transcription...
“Coupled transcription-translation” means _, and the coupling contributes to gene expression regulation via ___. A transcription can start before the end of translation, lacI repression B translation can start before the end of transcription, attenuation C translation can start before the end of transcription, CRP activation D transcription can start before the end of translation, LacI repression E translation can start only after transcription is achieved, attenuation Which of the following elements can terminate transcription in prokaryotes? It is ___...
How is switching sigma factors used to control gene expression? What type of organisms use this...
How is switching sigma factors used to control gene expression? What type of organisms use this method
Describe the structure of a typical eukaryotic gene, including only the cis-acting factors that are involved in transcription, pre-mRNA processing, and translation.
Describe the structure of a typical eukaryotic gene, including only the cis-acting factors that are involved in transcription, pre-mRNA processing, and translation. Discuss which cis-acting factors are present in the gene (DNA), the pre-mRNA, and the mature mRNA
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT