Question

In: Biology

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments:

Gene: 5’- A T G C T T C A A G T T G G T C C T C C T C C T T C G– 3’

Template: 3’- T A C   G A A G T T C A A C C A G G A G G A G G A A G C– 5’

Solutions

Expert Solution

he given sequence of the DNA is

5’- A T G C T T C A A G T T G G T C C T C C T C C T T C G– 3’

Since it is in 5' to 3' direction, it is the coding strand of the DNA.

the template strand of the DNA will be complementary to the coding strand of the DNA.

The sequence of the template strand DNA: 3’- T A C G A A G T T C A A C C A G G A G G A G G A A G C– 5’

Now, the mRNA will be synthesised by the process of transcription in which template DNA will act as a template for the mRNA synthesis. The mRNA will be complementary to the template strand of the DNA.

so, the sequence of mRNA will be: 5' AUG CUU CAA GUU GGU CCU CCU CCU UCG 3'

The translation is the process in which the polypeptide chain is synthesized with mRNA as a template. The tRNA and ribosomes assist this process. The mRNA consists of the nitrogenous base sequence which acts as the template. A codon is a three-base group in the mRNA which is used in the translation process. These codons are used as a recognition site for the anticodons to bind to them and the tRNA (where the anticodons are already located on the other side) release the one corresponding amino acid (located on that tRNA molecule) to the growing polypeptide chain. This process goes on and a polypeptide chain is produced.

So, the amino acid sequence will be: MET LEU GLN VAL GLY PRO PRO PRO SER

or in one-letter code, the amino acid sequence is: M L Q V G P P P S

Please hit on the like button if you are satisfied with the answer. Give comments for further clarification/assistance. Thanks! Have a good day.


Related Solutions

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that...
. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT a. Which strand of DNA is transcribed and in which direction? Support your response by indicating the 5 amino acid sequence that results when this transcript is translated. (2 pts) b. Label the 5’ and the 3’...
( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...
( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...
1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...
1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?
The following is a sequence of nucleotides in a DNA double helix that codes for a...
The following is a sequence of nucleotides in a DNA double helix that codes for a short polypeptide. The messenger RNA encoded by this DNA has both translational initiation and termination codons.                                     STRAND A: T T T A G T T A T C A A T C T T G G G T A G A A C                                     STRAND B: A A A T C A A T A G T T A G A A C...
DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield...
DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound such as RNA polymerase. Why is this method done in the absence of ribonu­cleotide triphosphates?
Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.
Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...
What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c) CAT d) AAA e) GCC f) TTC g) CCG h) TGT
1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...
1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?   2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT