1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

Expert Solution

1)The given coding strand is 5' GCGCAATATTTCTCAAAATATTGCGC3'

Template strand is 3' CGCGTTATAAAGAGTTTTATAACGCG 5

Complimentary strand will be 5' GCGCAATATTTTGAGAAATATTGCGC 3' ( when you are writing the single strand,must write it in the direction 5' to 3')

The speciality of this DNA sequence is palindrome and these sequence are inverted, repeat with two fold symmetry( can be equally divided).

coding strand : 5' GCGCAATATTTCTCAAAATATTGCGC 3'

Template strand : 3' CGCGTTATAAAGAGTTTTATAACGCG 5'

This sequence is self complemtary and they have the potential to from hairpin structure.This sequnce can also form cruciform. structure when these two strands are combined(put together).

2),The answer is Sphingolipids( sphingomycelin), it has one fatty acid molecule and a phosphocholine molecule attached to the sphingosine backbone, and the ratio of fatty acid to the inorganic phosphate is 1:1,. Glycerophospholipids have 2 fatty acid chains and one phosphate group, so the ratio of fatty acid to inorganic phosphate will be 2:1.

gladiator answered 2 years ago

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes. How many DNA fragments will you get? D) You choose to cut...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which...

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides within a codon. What would be the effects of a point mutation that would change a purine for a pyrimidine at position 2? 1. (True/False) This mutation will always result in an altered amino acid sequence in the mutant protein compared to the original protein. 2. (True/False) The mutant amino acid, if changed,...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

Question