In eukaryotic promoter recognition, the multi-subunit protein ___________ recognizes and binds to the

In eukaryotic promoter recognition, the multi-subunit protein ___________ recognizes and binds to the ___________ ___________ consensus sequence, and recruits RNA polymerase II to initiate transcription. In prokaryotic promoter recognition, consensus sequences at the ___________ and ___________ positions are recognized by the ___________ ___________, which is complexed with the RNA polymerase core enzyme.

Expert Solution

In eukaryotic promoter recognition, the multi-subunit protein ____TFIID_______ recognizes and binds to the ______TATAA_____ ____BOX_______ consensus sequence, and recruits RNA polymerase II to initiate transcription. In prokaryotic promoter recognition, consensus sequences at the ____-10_______ and _______-35____ positions are recognized by the ___Sigma protein________ ___________, which is complexed with the RNA polymerase core enzyme.

gladiator answered 2 years ago

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially...

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially used in the identification of promoter sequences was ________________. A more contemporary technique for identification of promoter sequences is the _________ _____________________ assay.

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme

Explain how aspirin recognizes and binds to its target protein, cyclooxygenase?

The alpha-s subunit of G proteins will be activated when __________. A) the alpha s-subunit binds...

The alpha-s subunit of G proteins will be activated when __________. A) the alpha s-subunit binds to GTP B) the alpha s-subunit is complexed with the G protein beta and gamma subunits C) the alpha s-subunit is translocated into the nucleus D) the alpha s-subunit is phosphorylated

Clindamycin binds to the 50S ribosomal subunit of bacteria. Using this information, respond to the following:...

Clindamycin binds to the 50S ribosomal subunit of bacteria. Using this information, respond to the following: a. Referring to the 5 modes or mechanisms of actions of antibiotics, which one applies to clindamycin? b. Is this a broad or narrow spectrum antibacterial agent? Explain c. Does clindamycin have selective toxicity for bacteria? Explain

Select the statement which best summarizes the initiation of translation. The large ribosomal subunit binds to...

Select the statement which best summarizes the initiation of translation. The large ribosomal subunit binds to the mRNA first and the small subunit binds last The small ribosomal subunit binds to the mRNA first and the large subunit binds last Both subunits of the ribosome bind to the mRNA simultaneously There is no large ribosomal subunit, only a small subunit

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

2. Protein purification a) Determine the subunit composition of a protein from the following information: Molecular...

2. Protein purification a) Determine the subunit composition of a protein from the following information: Molecular Mass by Gel Filtration: 200 kD Molecular Mass by SDS-PAGE: 100kD Mass by SDS-PAGE with 2-mercaptoethanol 40kD and 60 kD b) In what order would E, H, and V be eluted from a DEAE column at pH 8? c) You have a mixture of 3 proteins, one is 100 amino acids long, another 350 amino acids long, and the third is 600 amino...

Using DNase footprinting, show that the sigma subunit of prokaryotic RNA Pol binds to nucleotides from...

Using DNase footprinting, show that the sigma subunit of prokaryotic RNA Pol binds to nucleotides from -35 to -10 in the promoter region. a. Outline your experiment and draw and label the data. Explain how your data support this conclusion. b. Show and label the data for a similar experiment done using DMS footprinting rather than DNase foot printing. Explain how your data support this conclusion. You do NOT have to write out the experiment again.

Find the human hemoglobin subunit alpha protein on PDB (Protein Data Bank) protein database. Hint: You...

Find the human hemoglobin subunit alpha protein on PDB (Protein Data Bank) protein database. Hint: You can use also use PDB identifier “5HU6” to find human hemoglobin subunit alpha protein on PDB database. (a) Find the Experimental Data section on this protein page and report Method and Resolution used? (b) Find the Entry History section on this protein page and report Deposited Date and Deposition author(s)? (c) Find the secondary structure information for this protein structure. What secondary structure types...

Question