Question

1. Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’
2. What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence?
3. If you have an RNA transcript that is 100 bp, how many codons does it contain?
4. If you take the template DNA that is shown in question 1 and you mutate the 6^thnucleotide from A to G how does that impact the polypeptide sequence
5. Is it better to have a mutation that inserts 1 nucleotide or a deletion that deletes 3 nucleotides? Explain your answer

Answer 1

1. The complementary DNA sequence of the template strand above is 3 - ATGCTTACGCGATACATTCGA - 5

The complementary base pairing in DNA involves binding of Guanine(G) to Cytosine(C) by three hydrogen bonds and binding of Adenine (A) to Thymine(T) by two hydrogen bonds.

2. The complementary RNA sequence is 3 - AUGCUUACGCGAUACAUUCGA- 5.

The sequence of RNA is always similar to coding strand except it has Uracil( U) instead of Thymine( T). Coding strand is the one which is complementary to template strand.

3. A codon is a sequence of three nucleotides. If RNA has 100 bp then the number of codons it contains is 100/3=33

4. If 6th nucleotide in the template strand is mutated from A to G then the sixth nucleotide in mRNA sequence will become C instead of U. mRNA sequence after mutation will be 3- AUGCUCACGCGAUACAUUCGA-5

The codons before and after mutation are CUU and CUC . Both CUU ad CUC code for leucine. As both codons code for leucine hence there will be no impact on the polypeptide chain sequence.

5. It is better to have a mutation that deletes/ insert 3 nucleotides than a mutation that inserts 1 nucleotide. The deletion / insertion of 1 nucleotide result in frameshift mutation thereby leading to disruption of reading frame. On the other hand the deletion/ insertion of three nucleotides cause no shift in the reading frame.