Question

Transcription and Translation

1. Double strand of DNA:

5’-ATGTACCAGCATTCTCGATACCCT-3’

3’-TACATGGTCGTAAGAGCTATGGGA-5’

mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’

a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points)

b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points)

c) What is the peptide sequence of this piece of mRNA? There is a codon table at the end of this assignment you might find useful! And don’t forget the start codon. (1 point) 2. Template Strand of DNA: 5’-AATGTCACGAGATGAGTTCAT-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? (1 point) 2

3. Template Strand of DNA: 5’-CGATTGGCCACGCATGACTAA-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? (1 point)

4. Non-Template (coding) strand of DNA: 3’-CCAATATACGGTCTATGCGGT-5’

a) Write out the mRNA sequence, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? Hint: what was my advice in the lecture video in this situation. (1 point) /8 3

Answer 1

Transcription and Translation

1. Double strand of DNA:

5’-ATGTACCAGCATTCTCGATACCCT-3’

3’-TACATGGTCGTAAGAGCTATGGGA-5’

mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’

a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’

Answer- ii. 3’ – 5’  

b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA.

c) What is the peptide sequence of this piece of mRNA? There is a codon table at the end of this assignment you might find useful! And don’t forget the start codon.

Answer-AUG is the start codon and it will code for methionine. Group mRNA sequence in terms of 3 codon and then match codon for respective amino acid coded by codon.

mRNA strand made from the DNA: 5’-AUG UAC CAG CAU UCU CGA UAC CCU-3’

peptide sequence: Met- Tyr - Gln- His - Ser- Arg - Tyr - Pro   

2. Template Strand of DNA: 5’-AATGTCACGAGATGAGTTCAT-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- Write the complementary sequence in direction of 5' to 3' direction of mRNA synthesis. Make sure to write uracil instead of Thymine in mRNA.

mRNA sequence: 5' AUG AAC UCA UCU CGU GAC AUU 3'

b) What is the peptide sequence of this piece of mRNA?

Answer-

mRNA sequence:    5' AUG AAC UCA UCU CGU GAC AUU 3'

Peptide sequence- Met- Asn- Ser-  Ser- Arg - Asp- Ile

3. Template Strand of DNA: 5’-CGATTGGCCACGCATGACTAA-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- 3' GCU AAC CGG UGC GUA CUG AUU 5'

mRNA sequence- 5' UUA GUC AUG CGU GGC CAA UCG 3'

b) What is the peptide sequence of this piece of mRNA? (1 point)

Answer- Since AUG start codon is mid of mRNA sequence , so peptide synthesis will start from AUG start codon which is highlighted.

mRNA sequence: 5' UUA GUC AUG CGU GGC CAA UCG 3'

Peptide sequence:    Met - Arg- Gly - Pro- Ser  

4. Non-Template (coding) strand of DNA: 3’-CCAATATACGGTCTATGCGGT-5’

a) Write out the mRNA sequence, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- Template strand of DNA: 5' GGTTATATGCCAGATACGCCA 3'

mRNA sequence : 5' UGGCGUAUCUGGCAUAUAACC 3'

b) What is the peptide sequence of this piece of mRNA? Hint: what was my advice in the lecture video in this situation.

Answer- In this case, CUG will be used as a initiation codon to start peptide synthesis .

mRNA sequence : 5' UGGCGUAU CUG GCA UAU AAC C 3'

peptide sequence:   Leu - Ala - Tyr - Asn