Question

In: Biology

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation

1. Double strand of DNA:

5’-ATGTACCAGCATTCTCGATACCCT-3’

3’-TACATGGTCGTAAGAGCTATGGGA-5’

mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’

a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points)

b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points)

c) What is the peptide sequence of this piece of mRNA? There is a codon table at the end of this assignment you might find useful! And don’t forget the start codon. (1 point) 2. Template Strand of DNA: 5’-AATGTCACGAGATGAGTTCAT-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? (1 point) 2

3. Template Strand of DNA: 5’-CGATTGGCCACGCATGACTAA-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? (1 point)

4. Non-Template (coding) strand of DNA: 3’-CCAATATACGGTCTATGCGGT-5’

a) Write out the mRNA sequence, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction. (1 point)

b) What is the peptide sequence of this piece of mRNA? Hint: what was my advice in the lecture video in this situation. (1 point) /8 3

Expert Solution

Transcription and Translation

1. Double strand of DNA:

5’-ATGTACCAGCATTCTCGATACCCT-3’

3’-TACATGGTCGTAAGAGCTATGGGA-5’

mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’

a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’

Answer- ii. 3’ – 5’

b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA.

c) What is the peptide sequence of this piece of mRNA? There is a codon table at the end of this assignment you might find useful! And don’t forget the start codon.

Answer-AUG is the start codon and it will code for methionine. Group mRNA sequence in terms of 3 codon and then match codon for respective amino acid coded by codon.

mRNA strand made from the DNA: 5’-AUG UAC CAG CAU UCU CGA UAC CCU-3’

peptide sequence: Met- Tyr - Gln- His - Ser- Arg - Tyr - Pro

2. Template Strand of DNA: 5’-AATGTCACGAGATGAGTTCAT-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- Write the complementary sequence in direction of 5' to 3' direction of mRNA synthesis. Make sure to write uracil instead of Thymine in mRNA.

mRNA sequence: 5' AUG AAC UCA UCU CGU GAC AUU 3'

b) What is the peptide sequence of this piece of mRNA?

Answer-

mRNA sequence: 5' AUG AAC UCA UCU CGU GAC AUU 3'

Peptide sequence- Met- Asn- Ser- Ser- Arg - Asp- Ile

3. Template Strand of DNA: 5’-CGATTGGCCACGCATGACTAA-3’

a) Write out the mRNA sequence made from this piece of DNA, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- 3' GCU AAC CGG UGC GUA CUG AUU 5'

mRNA sequence- 5' UUA GUC AUG CGU GGC CAA UCG 3'

b) What is the peptide sequence of this piece of mRNA? (1 point)

Answer- Since AUG start codon is mid of mRNA sequence , so peptide synthesis will start from AUG start codon which is highlighted.

mRNA sequence: 5' UUA GUC AUG CGU GGC CAA UCG 3'

Peptide sequence: Met - Arg- Gly - Pro- Ser

4. Non-Template (coding) strand of DNA: 3’-CCAATATACGGTCTATGCGGT-5’

a) Write out the mRNA sequence, making sure you list the 5’ end first. Remember, nucleic acids are created in the 5’-3’ direction.

Answer- Template strand of DNA: 5' GGTTATATGCCAGATACGCCA 3'

mRNA sequence : 5' UGGCGUAUCUGGCAUAUAACC 3'

b) What is the peptide sequence of this piece of mRNA? Hint: what was my advice in the lecture video in this situation.

Answer- In this case, CUG will be used as a initiation codon to start peptide synthesis .

mRNA sequence : 5' UGGCGUAU CUG GCA UAU AAC C 3'

peptide sequence: Leu - Ala - Tyr - Asn

gladiator answered 2 years ago

During transcription, the strand of DNA that base pairs with the new mRNA is called the:...

During transcription, the strand of DNA that base pairs with the new mRNA is called the: a) Parental strand b) Template strand c) Nontemplate strand d) Coding strand

Know all the structures and associated terms involved in transcription and translation: dna, mrna, trna, rna...

Know all the structures and associated terms involved in transcription and translation: dna, mrna, trna, rna polymerase, transcription factors, promoter (ex: tata box), transcription unit, terminator, introns, exons, ribozymes, codon, anticodon, start codon, stop codon, release factor, polypeptide, amino acid, and ribosome (small and large ribosomal subunits)

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Arrange the steps of transcription of DNA to synthesize mRNA.

Arrange the steps of transcription of DNA to synthesize mRNA. Rank the steps of transcription of DNA to synthesize mRNA. To rank items as equivalent, overlap them.

DNA strand mRNA tRNA from Figure 2 Amino Acids (number and name) from Figure 3 pg...

DNA strand mRNA tRNA from Figure 2 Amino Acids (number and name) from Figure 3 pg 80 C C T G G A C C U 4 Glycine G A A G G T A C G T T A G T T G A C A T G A C G

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

#1: Gene Transcription and Translation Write a brief statement hypothesizing as to why mRNA is so...

#1: Gene Transcription and Translation Write a brief statement hypothesizing as to why mRNA is so unstable in most bacteria (t1/2 of about 1 minute), when the same half-life is more like 1 hour in higher organisms?