Question

In: Biology

Complete the chart below. DNA mRNA 5 ’ &nbsp

Complete the chart below.

DNA mRNA

5 ’ 3’

T --

A --

C ---

G ---

C ---

A --

T --

3’ 5’

Re-state the mRNA strand, write it in the 5’ to 3’ direction. Answer the following questions.

mRNA strand: 5’ __________________________ 3’

8. What is the first codon on the mRNA strand?

9. What is the anticodon for the tRNA at the P site?

10. What amino acid is this tRNA bringing?

11. What is the second codon on the mRNA strand?

12. What is the anticodon for the tRNA at the A site?

13. What amino acid is this tRNA bringing?

14. What forms between the two amino acids? Use the exact name of the union.

15. What is the third codon on the mRNA strand?

16. What is the anti-codon for the tRNA that will bind to the A site? Explain your answer.

17. What is the amino acid sequence of your peptide? Include STOP in your sequence.

18. How many kinds of codons exist in the Universal Code?

19. How many codons actually code for an amino acid?

20. What do the others code for?

21. How many different kinds of amino acids are coded for in the Universal Code?

Expert Solution

DNA template strand

5`-TTACGGCAT-3`

8) mRNA is complementary to the template strand, RNA polymerase adds U complementary to A, A complementary to T, G is complementary to C and vice versa.

mRNA is 5`-AUGCCGUAA-3`

9) anticodon is complementary to the codons in the mRNA ( A is complementary to U and C is complementary to G)

the first anticodon is

3`-UAC-5`

10) amino acid brought by the tRNA with anticodon 3`-UAC-5` is methionine.

11) the second codon in the mRNA is 5`-CCG-3`

12) the anticodon is complementary to the codons in the mRNA ( A is complementary to U and C is complementary to G)

the second anticodon is

3`-GGC-5`

13) amino acid brought by the tRNA with anticodon 3`-GGC-5` is proline.

14) amino acids are linked to each other via a peptide bond.

15) third codon is 5`-UAA-3`

16) anti-codon is 3`-AUU-5`

the anticodon is complementary to the codons in the mRNA ( A is complementary to U and C is complementary to G).

17) 5`-UAA-3`

is a stop codon, so the corresponding tRNA does not add any amino acid so the answer is STOP

18) there are 64 codon

19) only 61 codons codes for amino acid

20) three others are stop codons it does not code for any amino acid.

21) 20 amino acids are coded by the codons.

gladiator answered 1 year ago

Use the mRNA codon chart to translate this DNA message: DNA TAC TGC ...

Use the mRNA codon chart to translate this DNA message: DNA TAC TGC CAC ATT mRNA amino acid List the sequence of amino acids in this chain Suppose the sixth base in the DNA chain was an A instead of a C. How would this affect the protein produced? What is the name given to this type of mutation in a protein chain? Explain Which of the following bird species are most closely related? ...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids...

Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids this gene codes for, in the following DNA strand1 : ATG _____ _____ _____ _____ _____ CGC DNA strand 2 : *_____ GCC _____ _____ _____ AGT _____ mRNA : _____ _____ AUA _____ UUU _____ _____ tRNA : _____ _____ _____ UAC _____ _____ _____ Amino acids : ______ ______ _____ _____ ______ ______ ______ (Remember which type of RNA actually...

Consider the following segment of mRNA produced by the normal order of DNA nucleotides: 5' UCU...

Consider the following segment of mRNA produced by the normal order of DNA nucleotides: 5' UCU AAG CGA GUU 3' What is the amino acid order if an insertion mutation adds a G to the beginning of the mRNA segment? What is the amino acid order if a deletion mutation removes the U at the beginning of the mRNA segment?

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemp

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemplate DNA strand Slide 33 problem: The following sequence of nucleotides in a DNA strand was used as a template to synthesize a mRNA that was then translated into protein: 5’-TTAACGGCTTTTTTCCAT-3’ Predict the C-term aa and the N-term aa of the resulting polypeptide. Slide 34 problem: True or False? Explain your answer! 1.An individual ribosome can make only one type of protein. 2.The large and small subunits of an individual...

Question

Complete the chart below. DNA mRNA 5 ’ &nbsp

Solutions

Expert Solution

Related Solutions