Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3...

Suppose the DNA bases in a gene sequence follow the distribution:

DNA base	Probability
A	1/3
C	θ
G	1/3
T	1/3 - θ

In an experiment, the number of observed bases that are “A” or “C” in a gene sequence is x, and the number of observed bases that are “G” or “T” is y. The EM method is used to find the best value for the parameter θ. Describe the Expectation step for computing the expected numbers of A, C, G, and T bases and the Maximization step for estimating θ. Give formulas for the estimations and detailed steps about how to obtain the formulas.

Expert Solution

orchestra answered 1 year ago

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Suppose an extra base pair is inserted into the coding sequence of a particular gene during...

Suppose an extra base pair is inserted into the coding sequence of a particular gene during replication. Describe how this may affect the translation of the polypeptide chain encoded by the gene.

1. In DNA, the type of bonds that form the base pairing between the bases, A::T...

1. In DNA, the type of bonds that form the base pairing between the bases, A::T and C::G are? a. ionic bonds b. peptide bonds c. H-bonds d. covalent bonds 2. If you wanted to build a short DNA strand, which of the following nucleotides would you not use? Select one: a. dTTP b. dUTP c. dGTP d. dCTP

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the...

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the 5? to 3? direction because __________. 1. each strand of RNA or DNA has an unlinked 3? carbon and an unlinked 5? carbon 2. DNA and RNA are synthesized in this direction in cells 3. DNA strands are antiparallel 4. nucleotides are added to the 5? end of the nucleic acid

A DNA string is a sequence of the bases a, c, g, and t in any...

A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

If the DNA sequence in the question above is at the BEGINNING of a gene, what...

If the DNA sequence in the question above is at the BEGINNING of a gene, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, alanine alanine, lysine methionine, asparagine

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and...

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and translate the wild type and mutant proteins. 2. Classify the type(s) of mutation(s) in gene A the mutant has. 3. Design a primer pair to generate a PCR fragment of any size from the wild type sequence. Write the primer pair and mark the 5’ and 3’ of each primer sequence. wild-type gene 5’ TAG|ACC|ATG|CCA|GTA|AAT|TTA|CGA|TGA|CA 3’ 3’ ATC|TGG|TAC|GGT|CAT|TTA|AAT|GCT|ACT|GT 5’ mutant 2 5’ TAG|ACC|ATG|CCA|GTA|AAT|ATG|TTA|CGA|TGA|CA 3’ 3’ ATC|GGG|TAC|GGT|CAT|TTA|TAC|AAT|GCT|ACT|GT...

Question