4. In your studies with mice, you have sequenced a piece of wild-type DNA and it...

4. In your studies with mice, you have sequenced a piece of wild-type DNA and it clearly contains a gene, but you do not know what this gene does. Therefore, to investigate further, you would like to create a transgenic mouse to learn more about the phenotypic qualities this gene confers. What kind of transgenic mouse would allow you to correctly determine any phenotypes that depend on this gene’s function? How would you go about making such a mouse?

Solutions

Expert Solution

One of the widely used method to create a transgenic mice is pronucleus method. In this technique, a microinjection containing gene of interest (transgene) is directly injected into the male pronucleus of a fertilized eggs. The transgene is capable of incorporating inside the nucleus of eggs via process of recombination. The fertilized eggs are allowed to undergo multiple divisions until they reach blastocyst stage and become embryos. These embryos are injected into the uterus of foster mother which delievers pups after 20 to 25 days. Then, a piece of tissue from tail or ear is derived to extract DNA which is amplified and genotyped to determine the function of the transgene.

gladiator answered 1 week ago

Next > < Previous

Related Solutions

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC-3' Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5' - CCCTAGTTAAAAC-3' Fragment 4: 5' - ACCGCAATACCCTAGTT - 3' Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3' Fragment 6: 5' - ATTTACCGCAAT - 3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA

You have isolated and sequenced a region of DNA that appears to have caused tumor formation....

You have isolated and sequenced a region of DNA that appears to have caused tumor formation. For What types of mutations would you look to understand how that DNA causes the cancer and what is the characteristic of each type of mutation you might find?

Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below...

Phenotypes to Genotypes- Background: The IAA3 from wild-type Arabidopsis has been sequenced and is included below as the top strand in the 5’ to 3’ orientation. 1 gctgttactg ctaccgacaa gcttagcttt ttttcctttg tccttaattc agaaaacagt 61 ttcttctctc tctaccagta tctatcttta ttctccttta acttgtataa aacactcagc 121 ttcctcgaag cctctcatct tcatcatcag cagcttctct atatctctcc tctctttcaa 181 ggataataac caaaagcttt tctttttatc ttctcctgca attcttgaag aaatggatga 241 gtttgttaac ctcaaggaaa cagagctgag gctgggatta ccgggaacag ataatgtatg 301 tgaagcaaaa gagagagttt cttgctgtaa taacaacaat aagagagtac tatcaactga 361 tactgagaag gagattgaat catcatcaag gaaaactgaa acatcccctc ctcgaaagta 421 agttaaactc acacaaaagt ctctgaatct gtagtggtgg...

A. You have your own p53 gene sequenced and notice that you have 1 mutation in...

A. You have your own p53 gene sequenced and notice that you have 1 mutation in the portion of the protein that binds to DNA. You also notice that the mutation is a silent mutation. Are you at a higher risk then someone with wild type p53 to develop p53 related cancers? Explain your answer in 1 sentence.

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and...

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and translate the wild type and mutant proteins. 2. Classify the type(s) of mutation(s) in gene A the mutant has. 3. Design a primer pair to generate a PCR fragment of any size from the wild type sequence. Write the primer pair and mark the 5’ and 3’ of each primer sequence. wild-type gene 5’ TAG|ACC|ATG|CCA|GTA|AAT|TTA|CGA|TGA|CA 3’ 3’ ATC|TGG|TAC|GGT|CAT|TTA|AAT|GCT|ACT|GT 5’ mutant 2 5’ TAG|ACC|ATG|CCA|GTA|AAT|ATG|TTA|CGA|TGA|CA 3’ 3’ ATC|GGG|TAC|GGT|CAT|TTA|TAC|AAT|GCT|ACT|GT...

3. You are working with wild-type cells that have a 16h doubling time. BrdU is a...

3. You are working with wild-type cells that have a 16h doubling time. BrdU is a molecule that can be used to measure the amount of DNA inside cells. When added to cell culture, cells will incorporate BrdU into DNA strands during replication as if it were the DNA base thymidine (T). Your general experiment for using BrdU is: 1. Add BrdU to the media and let the cells continue to grow for 16h 2. Harvest cells and label them...

You have a true-breeding wild-type strain of fish that have rounded scales. A colleague of yours...

You have a true-breeding wild-type strain of fish that have rounded scales. A colleague of yours gives you a mutant fish that is naked (no scales). When you cross your wild type fish with your friends naked fish all of the F1 offspring are wild type. a) From this information alone, what are the possible genotypes of your fish, your friend’s fish (the parents) and their offspring? b) Based on these hypothesized genotypes what do you expect the outcome of...

You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...

You have a piece of double stranded DNA that is 300 base pairs and 50% guanine 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?

1) Comparing the wild-type and mutated template DNA strand, what kind of mutation is present?: 1)...

1) Comparing the wild-type and mutated template DNA strand, what kind of mutation is present?: 1) Wild-type template DNA: 3’ -T A C T G A C T G A C G -5’ Mutated template DNA: 3’ -T A C T G A C T A A C G -5’ What kind of mutation is present below? A) Missense B) Nonsense C) silent D) Frameshift 2) How do B cell and T cell receptors differ? A. TCRs are only able...

You have an Hfr strain of E. coli that contains wild-type genes for maltose catabolism and...

You have an Hfr strain of E. coli that contains wild-type genes for maltose catabolism and alanine biosynthesis. You want to transfer these two genes into an F- strain that cannot use maltose and is auxotrophic for alanine, by conjugation. Your Hfr strain also has a tetracycline resistance gene located distal to the origin of transfer. You have a P1 phage suspension and any ONE strain of E. coli given in the MBIO 2020 lab manual at your disposal. Outline...

Subjects