Questions
1. The blob operon produces enzymes that convert compound A into compound B. The operon is...

1. The blob operon produces enzymes that convert compound A into compound B. The operon is controlled by a regulatory gene S. Normally, the enzymes are synthesized only in the absence of compound B. If gene S is mutated, the enzymes are synthesized in the presence and in the absence of compound B. Does gene S produce a regulatory protein that exhibits positive or negative control? Is this operon inducible or repressible?

2.A mutation prevents the catabolite activator protein (CAP) from binding to the promoter in the lac operon. What will the effect of this mutation be on transcription of the operon?

3.Compare the regulation of the lac operon and the effect on the production of ß-galactosidae when E. coli is grown under the following conditions:

a) In the presence of high levels of lactose and absence of glucose

b) In the presence of high levels of lactose and high levels of glucose

In: Biology

Introduction 1. What do these terms mean? a. Catalase b. Oxidative stress c. Pathogen d. Surfactant...

Introduction

1. What do these terms mean?

a. Catalase

b. Oxidative stress

c. Pathogen

d. Surfactant

e. Sigma S (RpoS, product of the rpoS gene)

f. Azide

2. What research question are the authors trying to answer?

3. What is the authors’ hypothesis?

4. Why do they want to test activity for HPII on clinical isolates of pathogenic E. coli?

5. What is their rationale for conducting the present study?

Article Link: https://documentcloud.adobe.com/link/review?uri=urn:aaid:scds:US:814b91f5-128c-44b5-806e-faba7dd5ce06#pageNum=1

In: Biology

DNA replication requires many enzymes to accomplish the process successfully. This results in a replication process...

DNA replication requires many enzymes to accomplish the process successfully. This results in a replication process that is known to be bi-directional, semi-conservative and semi-discontinuous. You discover a new prokaryotic organism that lacks the gene coding for an DNA polymerase I enzyme, and therefore this enzyme is not made in this species. Additionally, the DNA polymerase III enzyme from this organism lacks any 3’ to 5’ nuclease activity but has 5’ to 3’ nuclease activity. Based on what you know about DNA replication and the functions of DNA polymerase I and DNA polymerase III, discuss the effect of these changes on DNA replication in this organism. Please explain your answer in full.

In: Biology

Easy Plant bio question 4. What are 5 reasons scientists think Arabidopsis is amazing?

Easy Plant bio question

4. What are 5 reasons scientists think Arabidopsis is amazing?

In: Biology

How do segment polarity genes differ in their mode of action from the gap and pair-rule...

How do segment polarity genes differ in their mode of action from the gap and pair-rule genes? Explain why and give examples.

In: Biology

Virus is a typical endogenous antigen. First explain its pathway of antigen presentation, second how many...

Virus is a typical endogenous antigen. First explain its pathway of antigen presentation, second how many mechanisms do we have in immune response against virus infection?

In: Biology

Write one-page essay discussing the following questions: all gene products are only proteins. We also learned...

Write one-page essay discussing the following questions: all gene products are only proteins. We also learned that DNA (in the form of genes within the chromosomes) is controlling all the chemical changes, which take place in cells. that living things are composed not only from proteins, but from also other molecules like lipids, carbohydrates, and others are these statements contradictory to each other? And how DNA is controlling all chemical changes but it can just code for proteins?

In: Biology

The frequency of the sickle cell allele is high in populations at low elevations in East...

The frequency of the sickle cell allele is high in populations at low elevations in East Africa, where mosquitos breed year-round, and lower in high elevation populations where mosquitos are much less abundant. Which, if any, evolutionary processes might contribute to these differences in allele frequencies? Explain your answer.

In: Biology

For each of the scenarios below: a) state why evolution is occurring b) state whether mutation,...

For each of the scenarios below:

a) state why evolution is occurring

b) state whether mutation, natural selection, genetic drift or gene flow appears to be the mechanism of evolution

c) and describe why you picked a particular mechanism of evolution

Scenario 1: Researchers have been studying an isolated, small population of wolves (fewer than 30 individuals) on Isle Royale in Lake Superior for the past 30 years. This year they find that there are only 16 individuals left in the population and only 1 of these individuals is a female.

Scenario 2: A large population of colonially nesting (large groups of individuals nest together in a colony) shorebirds varies in plumage color from very white to dark gray. During the breeding season, a train derailment causes a toxic substance to flow into a lake where the colony is located. Approximately 75% of the mating individuals in the colony die. During the following breeding season, researchers notice that almost all of the individuals in the population have medium to dark gray plumage.

In: Biology

a) Explain what factors, structures, and ion channels contribute to establishing and maintaining the resting membrane...

a) Explain what factors, structures, and ion channels contribute to establishing and maintaining the resting membrane potential. Draw a cell and show all relevant contributors to the resting membrane potential with explanations of how they contribute to establish and maintain the resting membrane potential.

b)  What cells have a resting membrane potential? Is it only nerve and muscle (excitable) cells?

In: Biology

Describe the role of the hypothalamus and pituitary gland in controlling metabolic rate. (4 marks).

Describe the role of the hypothalamus and pituitary gland in controlling metabolic rate. .

In: Biology

1. How do enzymes benefit chemical reactions within living organisms? What are some examples of enzymes?...

1. How do enzymes benefit chemical reactions within living organisms? What are some examples of enzymes? Provide at least 3 examples of specific enzymes found within living things.
2. What molecules store energy within living organisms? Provide at least 2 examples.
3. Why is water so important within living organisms? What are some of the functions of water within living organisms?
4. What is an element that is known to be toxic to living organisms? Be sure to name the element, give its symbol, and at least one harmful effect it has on a living organism.

In: Biology

membrane transport refers to the mechanisms by which solutes cross the pasma membrane, but there are...

membrane transport refers to the mechanisms by which solutes cross the pasma membrane, but there are additional prockaryotype cell structures through which a solute would pass when entering or exiting a cell,. Sequence the path of a solute from.....

In: Biology

what are the affinities of H. floresiensis to Homo habilis?

what are the affinities of H. floresiensis to Homo habilis?

In: Biology

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples...

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.

A) agarose gel

B) sample mixture

C) positively charged electrode

D) negatively charged electrode

2. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

A) four

B) three

C) five

D) two

3. The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?

A) four

B) three

C) five

D) two

In: Biology