please provide information about Taxus baccata  in your own words at least 50

including

physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

please provide information about bambusa in your own words at least 50

including

description, physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

please provide information about Gnetophyta in your own words at least 50

including

physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

Explain the function of the sarcoplasmic reticulum and T tubules in skeletal muscle contraction.

Summary:

Answer the following questions in detail. You have three hours to complete the final exam.

Question 1:

Student life is full of stressors. Give three sources of stress and explain how they affect students’ academic performance.

Question 2:

Time management is one way colege students can use to reduce stress. Give three time management techniques and explain how they can halp students manage their time better and improve their academic performance.

·     A strain of yeast requiring both tyrosine (tyr-) and arginine (arg-) is crossed to the wild type. After meiosis, the following 10 asci are dissected. Classify each ascus as to the segregational type (PD, NPD, TT). What is the linkage relationship between these two loci?

1             arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

2             arg+tyr+               arg+try+               arg-tyr-                arg-tyr-

3             arg-tyr+               arg-tyr+               arg+tyr-               arg+tyr-

4             arg-tyr-                arg-tyr-                arg+tyr+               arg+tyr+

5             arg-tyr-                arg-tyr+               arg+tyr-               arg+tyr+

6             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

7             arg-tyr-                arg+tyr+               arg-tyr+               arg+tyr-

8             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

9             arg+tyr+               arg-tyr-                arg-tyr-                arg+tyr+

10           arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

Regarding an epidemiological outbreak ,discuss the four major routes by which pathogens spread.Also, discuss methods that one would introduce to stop the spreading of pathogens

1) Given your understanding of transcription and translation, fill in the items below with the proper sequences. Please align your answers under the nontemplate DNA strand. Ignore RNA stop codons if they are present.

Nontemplate strand of DNA:                 5′- A T G T A T G C C A A T G C A -3′

     Template strand of DNA:       

                                 RNA:       

             Anticodons on tRNA:      

            Amino acid sequence:

2) Original template strand of DNA:  3′- T A C G C A A G C A A T A C C G A C G A A -5′

a. Transcribe this sequence:

                                      RNA:

b. Translate the RNA sequence. Ignore start/stop codons if present.

                 Amino acid sequence:

3) The table below lists five single-base point mutations that may occur in DNA. What happens to the amino acid sequence as a result of each mutation? (Position 1 refers to the first base at the 3′ end of the DNA strand. Position 21 would refer to the last base at the 5’ end.). Note that amino acids are numbered from L à R as 1-7.

Original template strand:  3’ TACGCAAGCAATACCGACGAA 5’

                   RNA strand:

     Amino acid sequence:                                                            (number aa’s 1-7 L-R)

Describe the structure and function of each of the following blood cells
Basophil,Eosinophil, Neutrophil,Monocytes,Macrophage and Dentritic cells

PARASITOLOGY QUESTION:

Amoeba case study

Calatagan is a third-class municipality in the province of Batangas, Philippines. It has a total population of 30,500 with a total of 8 barangays. The municipality’s major revenue comes from agriculture and aquaculture. A section of the population is employed in “Ang Pulo,” an island housing a mangrove forest conservation park located in the northeast. Some residents of Calatagan are settled along the major highway that connects it to neighboring municipalities, while some live further inland, usually near farms. Major streets are cemented but small streets are not. Deep well is the main source of water but there is one water distillery station serving three barangays in the municipality. In the summer of 2005, there were 950 cases of a rare eye infection in one barangay that affected residents of different ages. The infection is characterized by severe pain and reddening of the cornea. Antiviral drugs where administered but the patients’ condition did not improve. There were also 1500 reported cases of diarrhea by the RHU. Stool examination results from specimens submitted by patients revealed an increase in WBC count. Strange crystal-like structures were also seen under the microscope in some of the stool specimens. The mayor of Calatagan ordered an immediate investigation of the probable cause of the cases.

Questions to answer:

1. Identify the probable cause of the incidents in Calatagan, Batangas. Justify. (provide references for your answers)

2. What could have been the sources of infection of the residents in Calatagan? Describe the probable mode of infection for each identified cause. Cite examples and references.

3. Briefly provide a possible plan of action on how to control the cases in Calatagan.