Question

In: Biology

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...

What kinds of materials obtained from a crime scene might contain DNA? (2 pts)

Consider the following DNA molecule

5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ

3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ

How many bp is the original fragment? (1 point)

The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ          

                                                                                3ʹ CC˄GG 5ʹ

If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point)

If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point)

Consider the following DNA molecule

5ʹ ATTCGCGAATTCGGTACCGAATTGGCAGATTCGCCGAATTCCCGTACGGAATTAGTTAAC 3ʹ

3ʹ TAAGCGCTTAAGCCATGGCTTAACCGTCTAAGCGGCTTAAGGGCATGCCTTAATCAATTG 5ʹ

How many bp is the original fragment? (1 point)

(Recognition site for EcoRI is given previously)

If digested with EcoRI, how many fragments are formed if the DNA is linear? (1 point)

If digested with EcoRI, how many fragments are formed if the DNA is circular? (1 point)

Using the results from question #2 (for linear DNA), draw the results on a gel( “—“ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

A                 B

Solutions

Expert Solution

1) Teeth, hair, blood, semen and various body fluids can be found in the objects used in the crime scene. Therefore, such objects are collected carefully which may have blood stains, hair, semen, vaginal fluids, tissues or any other fluids.

2a) 65 bp (Base Pairs).

5? CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3?

3? GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5?

Adenine pairs with thymine (A-T or T-A) and guanine pairs with cytosine (G-C or C-G). Count one strand to find number of bases and the total is equal to bases on other strand. Therefore, number of base pair

Enzyme HaeIII - restriction site - 5? GG?CC 3?   

3? CC?GG 5?

The enzyme cuts at GG and CC in 5' to 3' strand and at CC and GG in 3' to 5' strand.

(2b) if the DNA is linear : Number of fragments = 5

5? CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3?

3? GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5?

The enzyme cuts the linear DNA at four sites and the resulting fragment number is 5.

(2c) if the DNA is circular : number of fragments = 4

The enzyme cuts the circular DNA at four sites and the resulting fragment number is 4.

Gel :


Related Solutions

.If DNA from a crime scene must be compared to other DNA patterns to determine whose...
.If DNA from a crime scene must be compared to other DNA patterns to determine whose DNA it is why is it considered to be more accurate that fingerprinting?
In electrophoresis of suspect DNA in the crime scene, what does it mean when when we...
In electrophoresis of suspect DNA in the crime scene, what does it mean when when we say that DNA samples were fragmented? What would your gel look like if the DNA was not fragmented? Explain using scientific evidence (10 points)
1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run...
1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run on in an Argos rose gel electrophoresis? 2. Why is it necessary to stain the electrophoresis gel before measuring it?
Genomic DNA libraries are expected to contain DNA segments that might not be represented in a...
Genomic DNA libraries are expected to contain DNA segments that might not be represented in a particular tissue-specific cDNA library. List several examples of these types of segments.
1- What medicines contain ibuprofen and what is it used for? (2 pts) 2- Write the...
1- What medicines contain ibuprofen and what is it used for? (2 pts) 2- Write the chemical name and the molecular formula for the structure. (2 pts) 3- If you want to check the purity of the compound, which technique would you use? (2 pts) 4- (i) How many chiral centers are present in the structure? (ii) Draw the stereoisomers and assign R and S configuration to the structures. (4 pts) 6- Briefly explain what a Polarimeter is. How can...
What are the most common errors for CSI (crime scene investigators)? What common errors that often...
What are the most common errors for CSI (crime scene investigators)? What common errors that often happen REAL life not TV shows. Please provide me sources for your answer!! THANK YOU
1. What kinds of bonds would be expected in polymeric materials? 2. State the difference between:...
1. What kinds of bonds would be expected in polymeric materials? 2. State the difference between: a) Linear and branched polymers. b) Thermosetting and thermoplastic polymers.
Question 1 2 pts A barista at Starbucks has an hunch that there might be a...
Question 1 2 pts A barista at Starbucks has an hunch that there might be a gender difference in terms of preferred drinks. One morning, she decides to record the next 50 drink orders she takes from female customers and 50 drink orders from male customers. The data are listed in the table below. What are the variables being examined in this study? Drink Female Male Total count Drip coffee 5 5 10 Hot espresso drinks 20 15 35 Cold...
5. The KEGG and NCBI databases contain a wealth of information obtained from sequencing and analyzing...
5. The KEGG and NCBI databases contain a wealth of information obtained from sequencing and analyzing the complete genome of Acinetobacter baumannii 1656-2, which is a medically important oxidase negative (cytochrome c oxidase- negative) bacterium that is multidrug resistant. For this microorganism, which statement regarding oxidative phosphorylation is correct? This microbe possesses subunits of cytochrome c oxidase and therefore displays cytochrome c oxidase activity The formation of ATP depends directly on the oxidation of cytochrome c. The cytochrome bd complex...
briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime...
briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime scenes.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT