Question

In: Biology

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we...

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we say that DNA samples were fragmented? What would your gel look like if the DNA was not fragmented? Explain using scientific evidence (10 points)

Solutions

Expert Solution

The DNA molecule nothing but a chain of, sugars, and phosphates molecules found in every cell in our bodies. It contains a unique sequence which is different between any two people (other than twin). The process by which this uniqueness is detected is called DNA fingerprinting. This method used to identify individuals by characteristics of DNA. Restriction enzyme cut the DNA chain in specific restriction sites. Location of these restriction sites are varied from person to person. As a result the fragments which are generated from the chain are varied in length. DNA samples were fragmented means the collected DNA sample of suspects is fragmented using a specific restriction enzyme. During, criminal investigation to identify a person or to locate a person at a crime scene, DNA fingerprinting is used globally in forensic science. In this process, the DNA is extracted from any collected specimen (like blood, semen, skin, hair). After that, restriction enzymes are added to the sample to cut the DNA into the smaller segments that are different between individuals. The DNA segments are analysed by agarose gel electrophoresis and visualized by staining with ethidium bromide. Each individual has a signature fingerprint.

If, the DNA sample is not fragmented by using a restriction enzyme then a single band appears in the gel after ethidium bromide staining.


Related Solutions

.If DNA from a crime scene must be compared to other DNA patterns to determine whose...
.If DNA from a crime scene must be compared to other DNA patterns to determine whose DNA it is why is it considered to be more accurate that fingerprinting?
What does ‘antiparallel’ mean when referring to DNA?
What does ‘antiparallel’ mean when referring to DNA?
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ                                                                                           3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...
What does it mean when it is said that DNA replication is ‘semiconservative’?
What does it mean when it is said that DNA replication is ‘semiconservative’?
What does it mean when we say the DNA is two complimentary, and is composed of antiparallel chains of nucleotides?
What does it mean when we say the DNA is two complimentary, and is composed of antiparallel chains of nucleotides?
What does it mean when we say the DNA is two complimentary, and is composed of antiparallel chains of nucleotides?
What does it mean when we say the DNA is two complimentary, and is composed of antiparallel chains of nucleotides?
1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run...
1. Why can’t the DNA from a crime scene sample be extracted, fragmented and immediately run on in an Argos rose gel electrophoresis? 2. Why is it necessary to stain the electrophoresis gel before measuring it?
what does it mean when somefiles cannot be open during investigation of a suspect hard drive...
what does it mean when somefiles cannot be open during investigation of a suspect hard drive in digital crime? What actions should be taken by the investigator for such files??
What does it mean to linearize DNA?
What does it mean to linearize DNA?
what does it mean if DNA is coding
what does it mean if DNA is coding
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT