Question

In: Chemistry

1- What medicines contain ibuprofen and what is it used for? (2 pts) 2- Write the...

1- What medicines contain ibuprofen and what is it used for? (2 pts)

2- Write the chemical name and the molecular formula for the structure. (2 pts)

3- If you want to check the purity of the compound, which technique would you use? (2 pts)

4- (i) How many chiral centers are present in the structure? (ii) Draw the stereoisomers and assign R and S configuration to the structures. (4 pts)

6- Briefly explain what a Polarimeter is. How can it be helpful to characterize the ibuprofen structure? What information/results can be observed using this instrument? (5 pts)

7- What information does IR spectroscopy provide to identify the ibuprofen structure? (5 pts)

8- (i) What is NMR technique? (ii) What kind of information can it provide for the characterization of ibuprofen? (5 pts)

Solutions

Expert Solution

1- What medicines contain ibuprofen and what is it used for? (2 pts)

Ans: Non steroidal anti-inflammatory drug contains ibuprofen. It is used as analgesic, antipyretic also.

2- Write the chemical name and the molecular formula for the structure. (2 pts)

Ans: The molecular formula is: C13H18O2

The chemical name is 2-(4-Isobutylphenyl)propanoic acid,

Or

3- If you want to check the purity of the compound, which technique would you use? (2 pts)

Ans: We can check the purity of the compound by any of these techniques

a) Gas chromatography Mass spectroscopy (GC_MS)

b) NMR spectroscopy

4- (i) How many chiral centers are present in the structure? (ii) Draw the stereoisomers and assign R and S configuration to the structures. (4 pts)

Ans: One chiral carbon is present in the structure


Related Solutions

There are three parts to the question: 1) What are essential medicines? 2) Describe at least...
There are three parts to the question: 1) What are essential medicines? 2) Describe at least two reasons for a lack of access, or poor access, to medicines in a low or middle-income country. 3) Discuss a solution to one of the barriers to access medicines. You should be able to answer this in about one page.
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ                                                                                           3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...
1. For each item, write what is required using only English words. (a) (2 Pts.) The...
1. For each item, write what is required using only English words. (a) (2 Pts.) The converse, contrapositive, inverse and negation of \If George feels well, then George is is going to a movie or going dancing". (b) (2 Pts.) The converse, contrapositive, inverse and negation of \Anna is failing history and psychology, then Anna is not graduating". (c) (2 Pts.) The statement represented by the symbols below and the negation of such statement: 8s9c (M(s) ! (D(c) ^ T(s;...
The language is C++. 1. (4 pts) What is a constructor? Explain. 2. (3 pts) What...
The language is C++. 1. (4 pts) What is a constructor? Explain. 2. (3 pts) What is a class? Explain. 3. (3 pts) In your own words, what is a function overloading?
Pharmacology Research three prescribed medicines and three alternative medicines used to return the body to homeostasis....
Pharmacology Research three prescribed medicines and three alternative medicines used to return the body to homeostasis. List the pharmaceutical name, name used for marketing if different, pharmaceutical manufacture, benefits of use, and any potential side effects. Include any general information a provider or patient might need to know. For Alternative medicine: list the herb, supplement, or treatment, directions for use, any manufacturer, benefits, and any potential side effects.
(1) (5 pts) What are the differences between nominal GDP and real GDP? (2) (5 pts)...
(1) (5 pts) What are the differences between nominal GDP and real GDP? (2) (5 pts) Suppose the real GDP in 2016 is 1 trillion dollar and the real GDP in 2017 is 1.2 trillion dollar, what is the growth rate of the real GDP from 2016 to 2017? (3) (5 pts) Suppose the nominal GDP growth rate is 15% from 2016 to 2017, what is the inflation rate measured by the GDP deflator,(i.e. inflation rate)?
Part 2: MATLAB Exercise 1 (50 pts) Write a program that tells the user if a...
Part 2: MATLAB Exercise 1 (50 pts) Write a program that tells the user if a city of their choice is in a tropical, temperate, or polar region. Use the cities.txt file provided in the Files section of this class. Your program should read the data in that file, find the city given by the user, and return a text message with the information. If the city is not found, your program should write a message accordingly. To decide which...
1. (2 pts) Write the balanced molecular equation for the reaction that occurs when solutions of...
1. (2 pts) Write the balanced molecular equation for the reaction that occurs when solutions of HNO3(aq) and Sr(OH)2(aq) are mixed. In order to obtain full credit, you must include state (aq, s, l, or g) of each reactant and product. Answer:________________________________________ 2. (6.5 pts) A titration is performed to find the concentration of 15.00 mL of HNO3 and the end-point is obtained when 35.10 mL of 0.4500 M Sr(OH)2 are used. Find [HNO3]. Show work clearly, circle answer, and...
1. What is Internal Auditing base on the case provided? (5 pts) 2. 2. What is...
1. What is Internal Auditing base on the case provided? (5 pts) 2. 2. What is the Management Objective? Is the management objective clear? Explain your answer. (5 pts) 3. 3. Should the auditor accept or reject the engagement? Cite in the context the basis of your answer and relate it with the concept of our discussion (10 pts) 4. Give atleast 3 approaches/audit activities that the auditor should take for Tokyo on the assumption that the engagement was accepted?Explain...
1. (2 pts) What things do we need to be measured during the consolidation test? 2....
1. (2 pts) What things do we need to be measured during the consolidation test? 2. (2 pts) What is the difference between primary consolidation and secondary consolidation? 3. (4 pts) Using a semi‐log plot of time versus dial readings describe the procedure that are used to determine the coefficient of consolidation cv? 4. (2 pts) Does the laboratory sample in the consolidation test deform laterally? 5. (2 pts) How many drainage paths are there in a consolidation test? 6....
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT