What are the most common errors for CSI (crime scene investigators)? What common errors that often...

What are the most common errors for CSI (crime scene investigators)? What common errors that often happen REAL life not TV shows.

Please provide me sources for your answer!! THANK YOU

Expert Solution

Common errors in Crime Scene Investigation includes [1, 2]
1.	Forgetting to take crime scene photographs.
2.	Inability to collect perishable and minute items from crime scene.
3.	Improper evaluating victimology.
4.	Failure to comprehensive a locality canvass that extends for at least two-blocks.
5.	Inability to get a proper follow-up.
6.	Lack of coordination among team members.
7.	Improper coordination between medical and administrative team.
8.	Carrying inappropriate decisions

References

1. Belur J, Tilley N, Osrin D, Daruwalla N, Kumar M, Tiwari V. Police investigations: discretion denied yet undeniably exercised. Policing and Society. 2015;25(5):439-62.

2. Pearson JM, Law JR, Skene JA, Beskind DH, Vidmar N, Ball DA, Malekpour A, Carter RM, Skene JP. Modelling the effects of crime type and evidence on judgments about guilt. Nature human behaviour. 2018;2(11):856-66.

Sydney Mullin answered 1 year ago

When investigators find a footprint at a crime scene they use some information about foot length...

When investigators find a footprint at a crime scene they use some information about foot length in order to determine the criminal’s gender. If they find a very long footprint then they may conclude that the criminal is a man. But, without other evidence, how sure can the investigator be? Suppose that the distribution of men’s foot lengths (in centimeters) is approximately N (25, 4) and the distribution of women’s foot lengths is approximately N (19, 3). Please answer the...

Crime scene investigators have determined that an acrylic spray paint (polymethylmethacrylate, PMMA) was used to deface...

Crime scene investigators have determined that an acrylic spray paint (polymethylmethacrylate, PMMA) was used to deface the Mona Lisa. Leonardo used linseed oil. We would like a solvent that interacts more strongly with acrylic than with linseed oil. Based on their chemical structures, we can approximate the SSCED parameters of linseed oil as n-hexadecane and acrylic paint as methylethylketone. Do you recommend CHCl_3, toluene, or acetone as the solvent? Explain.

Define and identify key concepts related to crime-scene profiling and crime-scene basics.

-What are the most common medication errors? -What are risk factors for medication errors? -When can...

-What are the most common medication errors? -What are risk factors for medication errors? -When can medication errors occur? -Why must each error be thoroughly investigated and documented? -What are the advantages of documenting medication errors? You will need to cite your resources.

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we...

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we say that DNA samples were fragmented? What would your gel look like if the DNA was not fragmented? Explain using scientific evidence (10 points)

What are the common errors encountering in urinalysis?

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site 5ʹ GG˅CC 3ʹ 3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...

The police arrive at the crime scene at 9:00 AM. They immediately measure that the body...

The police arrive at the crime scene at 9:00 AM. They immediately measure that the body temperature of the deceased is 83 F. After they finish gathering evidence, a process which took exactly one hour, they measure the body again and the temperature is 81,F. The room temperature is 68 F. When was the murder committed? (Assume his body temperature normally was 98, as opposed to 98.6.)

Business Statistics Common Mistakes in Statistical Studies: Top 6 most common statistical errors made by data...

Business Statistics Common Mistakes in Statistical Studies: Top 6 most common statistical errors made by data scientists Data scientists are the rare breed of professionals who can solve the world’s thorniest problems. The data savvy professionals are believed to be a rare combination of statistical and computational ingenuity, however, these data pros are also prone to mistakes. While we have dived into the makings of a data scientists and covered the topic extensively, it is time to train the gaze...

The forensic technician at a crime scene has just prepared a luminol stock solution by adding...

The forensic technician at a crime scene has just prepared a luminol stock solution by adding 10.0 g of luminol into a total volume of 75.0 mL of H2O. a ) What is the molarity of the stock solution of luminal? molarity of luminol solution = 0.753 M b) Before investigating the scene, the technician must dilute the luminol solution to a concentration of 4.00×10?2 M . The diluted solution is then placed in a spray bottle for application on...

Question