What are the most common errors for CSI (crime scene investigators)? What common errors that often...

What are the most common errors for CSI (crime scene investigators)? What common errors that often happen REAL life not TV shows.

Please provide me sources for your answer!! THANK YOU

Expert Solution

Common errors in Crime Scene Investigation includes [1, 2]
1.	Forgetting to take crime scene photographs.
2.	Inability to collect perishable and minute items from crime scene.
3.	Improper evaluating victimology.
4.	Failure to comprehensive a locality canvass that extends for at least two-blocks.
5.	Inability to get a proper follow-up.
6.	Lack of coordination among team members.
7.	Improper coordination between medical and administrative team.
8.	Carrying inappropriate decisions

References

1. Belur J, Tilley N, Osrin D, Daruwalla N, Kumar M, Tiwari V. Police investigations: discretion denied yet undeniably exercised. Policing and Society. 2015;25(5):439-62.

2. Pearson JM, Law JR, Skene JA, Beskind DH, Vidmar N, Ball DA, Malekpour A, Carter RM, Skene JP. Modelling the effects of crime type and evidence on judgments about guilt. Nature human behaviour. 2018;2(11):856-66.

Sydney Mullin answered 1 year ago

When investigators find a footprint at a crime scene they use some information about foot length...

When investigators find a footprint at a crime scene they use some information about foot length in order to determine the criminal’s gender. If they find a very long footprint then they may conclude that the criminal is a man. But, without other evidence, how sure can the investigator be? Suppose that the distribution of men’s foot lengths (in centimeters) is approximately N (25, 4) and the distribution of women’s foot lengths is approximately N (19, 3). Please answer the...

Crime scene investigators have determined that an acrylic spray paint (polymethylmethacrylate, PMMA) was used to deface...

Crime scene investigators have determined that an acrylic spray paint (polymethylmethacrylate, PMMA) was used to deface the Mona Lisa. Leonardo used linseed oil. We would like a solvent that interacts more strongly with acrylic than with linseed oil. Based on their chemical structures, we can approximate the SSCED parameters of linseed oil as n-hexadecane and acrylic paint as methylethylketone. Do you recommend CHCl_3, toluene, or acetone as the solvent? Explain.

Define and identify key concepts related to crime-scene profiling and crime-scene basics.

-What are the most common medication errors? -What are risk factors for medication errors? -When can...

-What are the most common medication errors? -What are risk factors for medication errors? -When can medication errors occur? -Why must each error be thoroughly investigated and documented? -What are the advantages of documenting medication errors? You will need to cite your resources.

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we...

In electrophoresis of suspect DNA in the crime scene, what does it mean when when we say that DNA samples were fragmented? What would your gel look like if the DNA was not fragmented? Explain using scientific evidence (10 points)

What are the common errors encountering in urinalysis?

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site 5ʹ GG˅CC 3ʹ 3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...

The forensic technician at a crime scene has just prepared a luminol stock solution by adding...

The forensic technician at a crime scene has just prepared a luminol stock solution by adding 10.0 g of luminol into a total volume of 75.0 mL of H2O. a ) What is the molarity of the stock solution of luminal? molarity of luminol solution = 0.753 M b) Before investigating the scene, the technician must dilute the luminol solution to a concentration of 4.00×10?2 M . The diluted solution is then placed in a spray bottle for application on...

Part A) The forensic technician at a crime scene has just prepared a luminol stock solution...

Part A) The forensic technician at a crime scene has just prepared a luminol stock solution by adding 15.0 g of luminol into a total volume of 75.0 mL of H2O. What is the molarity of the stock solution of luminol? Part B) Before investigating the scene, the technician must dilute the luminol solution to a concentration of 5.00×10−2 M . The diluted solution is then placed in a spray bottle for application on the desired surfaces. How many moles...

(Legal reasoning): Suppose a crime has been committed. Blood is found at the scene for which...

(Legal reasoning): Suppose a crime has been committed. Blood is found at the scene for which there is no innocent explanation. It is of a type which is present in 1% of the population. a. The prosecutor claims: “There is a 1% chance that the defendant would have the crime blood type if he were innocent. Thus there is a 99% chance that he is guilty”. This is known as the prosecutor’s fallacy. What is wrong with this argument? b....

Question