Question

In: Biology

5. The KEGG and NCBI databases contain a wealth of information obtained from sequencing and analyzing...

5. The KEGG and NCBI databases contain a wealth of information obtained from sequencing and analyzing the complete genome of Acinetobacter baumannii 1656-2, which is a medically important oxidase negative (cytochrome c oxidase- negative) bacterium that is multidrug resistant. For this microorganism, which statement regarding oxidative phosphorylation is correct?

This microbe possesses subunits of cytochrome c oxidase and therefore displays cytochrome c oxidase activity

The formation of ATP depends directly on the oxidation of cytochrome c.

The cytochrome bd complex allows oxygen to be reduced by the quinone pool

Subunit a of the F-type ATPase has 876 amino acids

Solutions

Expert Solution

Acinetobacter baumannii is a well known pathogenic organism, which is negative for cytochrome c oxidase. Hence the first 2 options of this question can be ruled out.

As per the full genome sequencing data of Acinetobacter baumannii 1656-2 (GenBank: CP001921.1), the genome contains cytochrome bd-type oxidase. Presence of this gene in this organism support the bioenegetics through this protein. This gene is also expressed in a number of pathogenic bacteria. Cytochrome bd consists of 2 subunits - a CydA and CydB and a small protein called CydX. The enzyme acts as a catalyst to reduce oxygen to water. During this process, quinol acts as the reducing substance. During the entire process, electrons are generated, which causes the generation of a proton motive force, thereby resulting in synthesis of ATP using ATP synthase. But, since this process is not linked to proton pump, it has lower energy efficiency.

Cytochrome bd also plays other role in bacterial life cycle, like helping the bacteria in tolerating stress including the oxidative and nitrosative stress. It also has a role to play in bacterial virulence. Hence, many pathogenic bacteria contain this gene.


Related Solutions

Fashion Marketers can obtain a wealth of information from their own market customer databases. True False...
Fashion Marketers can obtain a wealth of information from their own market customer databases. True False QUESTION 4 One of the largest sources of secondary data is the federal government and its various agencies. True False 7 points    QUESTION 5 Marketing Research is used when a business needs to define the overall size and makeup of the customer base for a product. True False QUESTION 6 The type of research in which data is collected once from a random sampling...
(E-Commerce) Discuss the advantages of expert location systems over corporate databases that contain expert's information and...
(E-Commerce) Discuss the advantages of expert location systems over corporate databases that contain expert's information and knowledge. What are the disadvantages? Can they be combined? How?
You are given the following information obtained from a sample of 5 observations taken from a...
You are given the following information obtained from a sample of 5 observations taken from a population that has a normal distribution. 76 67 83 61 63 Develop a 98% confidence interval estimate for the mean of the population.
The internet is host to a wealth of information and much of that information comes from...
The internet is host to a wealth of information and much of that information comes from raw data that have been collected or observed. Many websites summarize such data using graphical methods discussed in this chapter. Find a website related to your major that summarizes data and uses graphs, and share it with the class. Let us know how it relates to your major and why it is of interest to you. My major is Accounting
Compare and contrast the information that may be obtained from a resume and the information from...
Compare and contrast the information that may be obtained from a resume and the information from an interview. Which do you think is most important? Why?    Give examples of questions that are appropriate and not appropriate for a manager to ask an applicant during a job interview. Why are some questions inappropriate?
You are interested in analyzing some hard-to-obtain data from two separate databases. Each database contains n...
You are interested in analyzing some hard-to-obtain data from two separate databases. Each database contains n numerical values -so there are 2n values total - and you may assume that no two values are the same. You’d like to determine the median of this set of 2n values, which we will define here to be the nth smallest value. However, the only way you can access these values is through queries to the databases. In a single query, you can...
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...
What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ                                                                                           3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...
The following information is obtained from Rapid Corporation’s financial records:
The following information is obtained from Rapid Corporation’s financial records:                                                             Units               Unit Cost                    Total Cost Jan. 1   Beginning inventory               100                     $10                          $ 1,000 Mar. 1 Purchased                                400                     $12                          $ 4,800 Mar. 5 Sold                                         (250)                  May 2 Purchased                                100                     $15                          $ 1,500 Aug. 1 Sold                                         (150) Oct. 3 Purchased                                100                     $25                         $ 2,500 Dec 31 Ending inventory                    300                       ?                                 ?             (Per physical count) Required:       Calculate the cost of the ending...
Credit Pulls Databases • Should consumers trust / rely on information from a so-called credit pulls...
Credit Pulls Databases • Should consumers trust / rely on information from a so-called credit pulls database? • What are the biggest problems with making financial decisions based on anecdotal, crowdsourced info? • Is it possible for an individual to independently and accurately predict his or her odds of getting approved for a given credit card and receiving a certain spending limit? Is it worth trying?
what types of information obtained from the genogram inform the understanding of the pathophysiology of a...
what types of information obtained from the genogram inform the understanding of the pathophysiology of a disease in an individual? give an example. describe the relationship of genetics to cancer. give an example of a genetic contribution to cancer with recommendations for screening family members.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT