Genomic DNA libraries are expected to contain DNA segments that might not be represented in a...

Genomic DNA libraries are expected to contain DNA segments that might not be represented in a particular tissue-specific cDNA library. List several examples of these types of segments.

Solutions

Expert Solution

Examples of DNA regions that are present in Genomic DNA libraries but may not be present in cDNA libraries are:

Promoter Sequences: Promoter sequences are not transcribed to RNA and would be absent from cDNA libraries while being present in Genomic DNA libraries.
Genes not expressed in tissue/developmental stage: Genomic DNA libraries contain all the DNA sequences present in an organism, regardless of expression. However, all genes are not expressed in all tissue types. For example, the Insulin gene is only expressed in Pancreatic beta cells and therefore the sequence of the insulin gene may not be present in a cDNA library from another tissue/cell type. Another example is Haemoglobin Alpha gene which is only expressed in Red Blood Cells and may not be found in cDNA from another tissue.
Alternate Splicing products:Several genes exist that are expressed as one isoform in one tissue and as another isoform in another tissue. This variation is achieved by alternate splicing, which causes different Exons to be stitched together to form the isoform for that particular cell type. A Genomic DNA library will contain all exon sequences, while a tissue specific cDNA may not have all sequences.

gladiator answered 1 month ago

Next > < Previous

Related Solutions

Answer these questions regarding DNA libraries: In creating a genomic DNA library, what is the FIRST...

Answer these questions regarding DNA libraries: In creating a genomic DNA library, what is the FIRST step? a. Fragmenting the DNA into manageable pieces b. Screening clones c. Transforming recombinant DNA into bacteria d. Ligating DNA into plasmids Sometimes artificial chromosomes (AC) constructed from bacterial (BACs) or yeast (YACs) DNA are used to harbor genomic DNA for libraries (e.g., the human genome project). Why are BACs/YACs often used instead of traditional plasmid DNA for the construction of genomic libraries?...

Discuss a) Genomic and complementary DNA (cDNA) libraries and b) The testing of pharmaceutical drugs.

You have constructed four different libraries: a genomic library made from DNA isolated from human brain...

You have constructed four different libraries: a genomic library made from DNA isolated from human brain tissue, a genomic library made from DNA isolated from human muscle tissue, a human brain cDNA library, and a human muscle cDNA library. You wish to clone the human gene encoding myostatin, which is expressed only in muscle cells. A. Assuming the human genome is 3×10^9 bp and that the average insert size in the genomic libraries is 100 kb, how frequently will a...

1. A bacteria contain a genomic island composed in several composite transposon.Why might this bacterium be...

1. A bacteria contain a genomic island composed in several composite transposon.Why might this bacterium be of concern medically?

What role does the Chelex play in the isolation of genomic DNA? A) binds DNA so...

What role does the Chelex play in the isolation of genomic DNA? A) binds DNA so that impurities can be washed away B) binds divalent metal cations that inhibit the PCR reaction C) prevents the single-stranded DNA from reannealing during PCR D) immobilizes DNA polymerase preventing its denaturation at high temperatures

Genomic methods and thinking about what their results might mean. One of the first genomic methods...

Genomic methods and thinking about what their results might mean. One of the first genomic methods to study nuclear organization genome-wide was DamID, which was first carried out using lamin B1 DamID. i. Explain how the DamID method works

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the...

What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following DNA molecule 5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ 3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ How many bp is the original fragment? (1 point) The enzyme HaeIII has the following restriction site 5ʹ GG˅CC 3ʹ 3ʹ CC˄GG 5ʹ If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) If digested with HaeIII, how many fragments are formed if the DNA is circular?...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What...

. You have extracted extrachromosomal DNA and genomic DNA from E. coli in the lab. What is the differentiating steps during the DNA isolation so that your target DNA is not contaminated with the other unwanted DNA (i.e. you are targeting extrachromosomal DNA, so you don’t want the genomic DNA, and vice-versa)? Why and how that step can differentiate between these groups of DNA

In python The following is a short section of genomic DNA: ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT 1. It comprises two...

In python The following is a short section of genomic DNA: ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT 1. It comprises two exons and an intron. The first exon runs from the start of the sequence to base number 63 (starting counting from zero), and the second exon runs from base 91 (also counting from zero) to the end of the sequence. Write a program that will print just the coding regions of the DNA sequence. 2. Using the data from part one, write a program...

Describe how a point mutation in genomic DNA may be detected by MLPA in a single...

Describe how a point mutation in genomic DNA may be detected by MLPA in a single tube. Highlight the critical elements of probes and primers used to detect a “wild type” and single nucleotide variant. Ensure the role of enzyme(s) required for this assay are explained.

Subjects