For the following sequence read that comes from an internal exon within a gene, what is...

For the following sequence read that comes from an internal exon within a gene, what is the amino acid sequence that is encoded?

5’ TTAAGTAGCCGCTAG 3’

Solutions

Expert Solution

The given sequence of the DNA is

5’ TTAAGTAGCCGCTAG 3’

Since it is in 5' to 3' direction, it is the coding strand of the DNA.

the template strand of the DNA will be complementary to the coding strand of the DNA.

The sequence of the template strand DNA: 3' AATTCATCGGCGATC 5'

Now, the mRNA will be synthesised by the process of transcription in which template DNA will act as a template for the mRNA synthesis. The mRNA will be complementary to the template strand of the DNA.

so, the sequence of mRNA will be: 5' UUA AGU AGC CGC UAG 3'

The translation is the process in which the polypeptide chain is synthesized with mRNA as a template. The tRNA and ribosomes assist this process. The mRNA consists of the nitrogenous base sequence which acts as the template. A codon is a three-base group in the mRNA which is used in the translation process. These codons are used as a recognition site for the anticodons to bind to them and the tRNA (where the anticodons are already located on the other side) release the one corresponding amino acid (located on that tRNA molecule) to the growing polypeptide chain. This process goes on and a polypeptide chain is produced.

So, the amino acid sequence will be: LEU SER SER ARG STOP (leucine serine serine arginine stop)

or in one-letter code, the amino acid sequence is: L S S R STOP

Please hit on the like button if you are satisfied with the answer. Give comments for further clarification/assistance. Thanks! Have a good day.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’ After the intron has been removed, what is the likely sequence of the mRNA?

The following sequence is a fragment from the normal version of the Social B gene of...

The following sequence is a fragment from the normal version of the Social B gene of Solenopsis daguerrei ants. You may need to use the codon table provided. DNA SocialB: 5’- ATG TCG GTA GCA TGT GTC TGC-3’ A transition mutation in the sequence results in a change in the 3rd amino acid of the polypeptide chain: Alanine is produced. The DNA sequence with the mutation (the one used to name the SNP 5’ to 3’) is_______. Options - a....

What if a gene has 1 exon. What processing steps it will go through before becoming...

What if a gene has 1 exon. What processing steps it will go through before becoming a mature mRNA? Will it go through splicing?

• What is a structural gene? • What is a regulatory sequence? • What is a...

• What is a structural gene? • What is a regulatory sequence? • What is a promoter? What is an operator? • What are the regulatory GENES and their promoters? What is a repressor? Are these genes considered part of the operon? Are they always located next to the genes they control?

The following is a portion of the non-template DNA sequence from the human ras gene. Answer...

The following is a portion of the non-template DNA sequence from the human ras gene. Answer the following questions about this gene and the effects of gene changes to the specified mutant sequence (mutation in BOLD). Normal human ras: 5’-acatgactgaatataaacttgtggtagttggagctggt-3’ Mutant human ras: 5’-acatgactgaacataaacttgtggtagttggagctggt-3’ a. (4) What is the normal human Ras amino acid sequence from this portion of the gene, starting with the first start codon? b. (2) Which amino acid from the normal sequence is mutated, and what...

If the DNA sequence in the question above is at the BEGINNING of a gene, what...

If the DNA sequence in the question above is at the BEGINNING of a gene, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, alanine alanine, lysine methionine, asparagine

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): 5’-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3’ Consider the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA that you determined in the previous question. What is the amino acid sequence of the polypeptide encoded by this mRNA? You must show and explain all work/evidence to receive credit.

What are the antibiotic resistant genes for doxycycline? If possible, give the gene sequence.

A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in...

A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in order to produce the corresponding protein in bacteria at a concentration sufficient to conduct in vitro biochemical studies. B) Another student mentions that her should have cloned the gene sequence using mRNA instead of genomic DNA. Is this a good suggestion? How does one go about doing this?

Subjects