Question

In: Advanced Math

What is the number of ordered sequences of length k where each digit is taken from...

What is the number of ordered sequences of length k where each digit is
taken from a set of size n?

What is the number of ordered sequences of length k where each digit is
taken from a set of size n without repetition?

What is the number of subsets of size k of a set of size n?

Expert Solution

FIRST PART:

There are choices for each of the places.

Therefore, number of ordered sequences of length where each digit is taken from a set of size

SECOND PART:

Since repetition is not allowed, the first place has choices, the second place has remaining choices, and so on.

Finally, the last place has choices.

Therefore, number of ordered sequences of length where each digit is taken from a set of size without repetition

THIRD PART:

Finding number of subsets of size is same as finding number of unordered sequences of length where each digit is taken from a set of size without repetition.

By previous calculations, number of such ordered sequences

But order of elements does not matter in a set.

i.e., for every subset , any permutation is also the same subset.

There are such permutations for every set.

So, number of such unordered sequences

i.e., number of subsets of size

Colby Messinger answered 2 months ago

Find the number of N digit sequences from the alphabet a, b, c, d with an...

Find the number of N digit sequences from the alphabet a, b, c, d with an even number of a's and an odd number of b's

Find a system of recurrence relations for the number of n-digit quaternary sequences that contain an even number of 2’s and an odd number of 3’s.

Find a system of recurrence relations for the number of n-digit quaternary sequences that contain an even number of 2’s and an odd number of 3’s. Define the initial conditions for the system. (A quaternary digit is either a 0, 1, 2 or 3)

Suppose that independent samples ( of sizes n(i) ) are taken from each of k populations...

Suppose that independent samples ( of sizes n(i) ) are taken from each of k populations and that population (i) is normally distributed with mean mu(i) and variance sigma^2, i = 1, ..., k. That is, all populations are normally distributed with the same variance but with (possibly) different means. Let X(i)bar and s(i)^2, i = 1, ..., k be the respective sample means and variances. Let phi = c(1)mu(1) + c(2)mu(2) + ... + c(k)mu(k), where c(1), c(2), ...,...

If one? three-digit number? (0 cannot be a left? digit) is chosen at random from all...

If one? three-digit number? (0 cannot be a left? digit) is chosen at random from all those that can be made from the following set of? digits, find the probability that the one chosen is not a multiple of 5 . (0,1,2,3,4,5,6)

Four numbers are selected without replacement from {1,2,3,4,5,6,7} to form a 4-digit number. What is the...

Four numbers are selected without replacement from {1,2,3,4,5,6,7} to form a 4-digit number. What is the probability that the number is greater than 6543?

1.Prove that{2k+1:k∈N}∩{2k2 :k∈N}=∅. 2.Give two examples of ordered sets where the meaning of ” ≤ ”...

1.Prove that{2k+1:k∈N}∩{2k2 :k∈N}=∅. 2.Give two examples of ordered sets where the meaning of ” ≤ ” is not the same as the one used with the set of real numbers R.

Let the natural number n have the decimal numeral 123,461,46d, where d is the units digit....

Let the natural number n have the decimal numeral 123,461,46d, where d is the units digit. Use divisibility tests to give all of the choices of d by which n is divisible. Complete parts (a) through (h) below. (a) For what value(s) of d is n divisible by 2? (Use a comma to separate answers as needed.) (b) For what value(s) of d is n divisible by 3? (Use a comma to separate answers as needed.) (c) For what value(s)...

1. What are the k-mers of length k = 21 for this sequence read in FASTQ...

1. What are the k-mers of length k = 21 for this sequence read in FASTQ format? @K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT + AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ [please be detailed, thanks]

A thermometer is taken from a room where the temperature is 23oC to the outdoors, where...

A thermometer is taken from a room where the temperature is 23oC to the outdoors, where the temperature is −1oC. After one minute the thermometer reads 15oC. (a) What will the reading on the thermometer be after 5 more minutes? (b) When will the thermometer read 0oC? ________ minutes after it was taken to the outdoors.

Write a program in Java with a Scanner. Given an array and a number k where...

Write a program in Java with a Scanner. Given an array and a number k where k is smaller than the size of the array, write a program to find the k'th smallest element in the given array. It is given that all array elements are distinct. Example: Input: arr[] = {7,10,4,3,20,15} k = 3 Output: 7