Question

9. If the following mutation occurs in COVID19 RNA

5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to

5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’, what most likely would be the outcome of such a change in its sequence:

1. A frameshift mutation effect

2. A silent mutation effect

3. No effect resulted from the mutation

4. A nonsense mutation effect

5. A missense mutation effect

10.To conduct molecular analyses of COVID19 RNA sequence, which of the following biotechnology should be used to amplify samples of RNA:

1. RNA Recombinant Plasmid Duplication

2. RNA Fingerprinting Replication

3. Polymers Chain Replication

4. Polymerase Copying Repeats

5. Polymerase Chain Reaction

11. When you are preparing a reaction tube that will undergo PCR in a thermocycler, what components would you include in the reaction tube:

1. A, G, T,C, reverse transcriptase, primers, DNA ligase

2. A,G,U,C, RNA polymerase, primers, RNA ligase

3. A,G,T,C, DNA polymerase, primers, DNA ligase

4. ddA,ddG,ddT,ddC, DNA polymerase, primers, DNA ligase

5. ddA,ddG,ddU,ddC, RNA polymerase, primers, RNA ligase

Answer 1

Question 10

Option C:-Polymerase chain reaction

RT-PCR is carried out for the amplification of RNA. It involves the combination of reverse transcriptase enzyme along with PCR to carry out amplification of the RNA molecule and produce n number of amplicons.

Question 11

Option A: Incorrect

Reason:- DNA polymerase is mixing from the list of chemicals. Reverse transcriptase enzyme is used to carry out RT-PCR

Option B:- Incorrect

Reason:-PCR is based upon the ability of the DNA polymerase enzyme to synthesize a complementary DNA strand using the template DNA strand. RNA polymerase and ligase are not used in PCR.

Option C:- Correct

Reason:-It includes key materials to carry out the amplification of the template DNA strand.

Option D:- Incorrect

Dideoxynucleotides are not used in PCR reactions. They are used in Sangers method of DNA sequencing

Option E:-Incorrect

Reason:-Here dideoxynucleotides are used instead of dNTP hence it is incorrect.