Question

1. It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5 viral genes begins with 5’ GGGUACAUGGUAGCC….3’, the starting amino sequence is:

a) N-terminal Tyr-His-Arg- C-terminal

b) N-terminal Gly-Tyr-Met-Val-Ala- C-terminal

c) N-terminal Val-Ala- C-terminal

d) N-terminal Pro-Met-Tyr-His-Arg-   C-terminal

e) N-terminal Met-Tyr-His-Arg-   C-terminal

2. Which of the following enzymes has the highest functional error?

a) RNA Polymerase 1

b) DNA Polymerase 1

c) DNA Polymerase 3

d) RNA Polymerase 2

e) DNA Polymerase 2

3. After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCCGUCGAG...3’ to 5’ GGGUACAUGGUAGCCCCCCGUCGCCCCGUAG….3’ which of the following describes the above event:

a) a multi-points mutation occurred

b) an insertion mutation occurred

c) an inversion mutation occurred

d) a point-series mutation occurred

Answer 1

1. Given mRNA,

5' GGG UAC AUG GUA GCC 3'

Amino acids are formed after the translation process. In this process, messenger RNA is used as a template for the synthesis of sequence of amino acids. Transfer RNA carries the codon and messenger RNA carries the anti codon. Both of them are associated with each other by ribosomal RNA which is present in the ribosomes. Interaction between one codon and one anti codon leads to the addition of one amino acid in the growing peptide chain. The process uses aminoacyl synthetase enzyme for the charging of transfer RNA and peptidyl transferase enzyme for the formation of peptide bond between amino acids in the growing peptide chain.

So, the sequence of amino acids will be,

N - gly tyr met val ala - C

OPTION B IS CORRECT

According to guidelines, only first question can be answered. Please give a good rating.