Question

In: Biology

In the guide RNA, is there greater stringency for homology at the 5’ or 3’ end...

In the guide RNA, is there greater stringency for homology at the 5’ or 3’ end of the RNA?

Where, precisely, does the CRISPR/Cas9 system digest the target DNA?

What class of enzyme is Cas9

Name two other gene editing systems that are distinct from CRISPR/Cas. Give one reason why the CRISPR/Cas9 system is preferred by 9 out of 10 scientists that recommend editing genomes?

How many different types of CRISPR/Cas systems are there in bacteria and archaea?

Solutions

Expert Solution

2) The functions of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR-associated (Cas) genes provides adaptive immunity in bacteria and archaea, enabling the organisms to respond to and eliminate invading genetic material.

In this case, invading DNA from viruses or plasmids is cut into small fragments and incorporated into a CRISPR locus amidst a series of short repeats (around 20 bps) and processed into crRNA.

The protein typically binds to guide RNA containing two distinct RNA molecules: crRNA and another called tracrRNA (or "trans-activating crRNA"). The two then guide Cas9 to the target site where it will make its cut.

The target DNA is complementary to a 20-nucleotide stretch of the crRNA.

Cas9, an endonuclease, cuts both strands of the DNA double helix, making double-stranded break. This break is then repaired by Non-homologous end joining.

3) Cas9 (CRISPR associated protein 9) is an RNA-guided DNA endonuclease enzyme

4) Besides CRISPR-Cas systems, several ‘gene editing’ technologies have recently been developed to improve gene targeting methods including transcription activator-like effector nucleases (TALENs) and zinc-finger nucleases (ZFNs).  

At present CRISPR-Cas systems is the fastest, cheapest and most reliable system for ‘editing’ genes.It has been used to treat cancer, hepatitis B or even high cholesterol, at somatic cell level. Currently the process has been used to change the somatic cells or non-reproductive cells but if the successful change in the germ line cell is possible then this genetic change can be passed to new generations.


Related Solutions

2.a) RNA polymerase adds RNA monomers to where? Select one: a. 3' end of the growing...
2.a) RNA polymerase adds RNA monomers to where? Select one: a. 3' end of the growing RNA transcript b. 5' end of the growing RNA transcript c. 5' end of the DNA template d. 3' end of the DNA template b) The "charging" of tRNA requires which of the following? Select all that apply. Select one or more: a. ATP b. Aminoacyl tRNA synthetase c. tRNA lacking an amino acid d. aminoacyl tRNA c) Which of the following is/are methods...
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’,...
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’, what most likely would be the outcome of such a change in its sequence: A frameshift mutation effect A silent mutation effect No effect resulted from the mutation A nonsense mutation effect A missense mutation effect 10.To conduct molecular analyses of COVID19 RNA sequence, which of the following biotechnology should be used to amplify samples of RNA: RNA Recombinant Plasmid Duplication RNA Fingerprinting Replication...
1) Why is the design of single guide RNA limited to sequences that are next to...
1) Why is the design of single guide RNA limited to sequences that are next to PAMs? a) PAM sites are necessary for endonucleases to create single strand breaks. b) Cas9 recognizes PAM sites to create double strand breaks. c) PAM sites are necessary for complementary base pairing. d) Single guide RNAs bind to PAMs. 2) What repair mechanism allows for the generation of precise mutations? a) base excision repair b) nonhomologous end joining c) double strand DNA break d)...
QUESTION 3 Regression Analysis Guide to marks: 20 marks – 5 for a, 10 for b,...
QUESTION 3 Regression Analysis Guide to marks: 20 marks – 5 for a, 10 for b, 3 for c, 2 for d Belinda, the accountant at Murray Manufacturing Company wants to identify cost drivers for support overhead costs. She has the impression that the staff spend a large part of their time ensuring that the equipment is correctly set up and checking the first units of production in each batch. Deborah has collected the following data for the past 12...
What is a single guide RNA, and what role does it play in CRISPR-Cas genome editing...
What is a single guide RNA, and what role does it play in CRISPR-Cas genome editing in eukaryotic cells?
If np greater than or equals 5 and nq greater than or equals​ 5, estimate Upper...
If np greater than or equals 5 and nq greater than or equals​ 5, estimate Upper P left parenthesis at least 8 right parenthesis with n equals 13 and p equals 0.6 by using the normal distribution as an approximation to the binomial​ distribution; if np less than 5 or nq less than ​5, then state that the normal approximation is not suitable. P(at least 8) =?
2.) Consider the following RNA sequence, which represents the beginning of an open reading frame: 5’-AUGGGACUAGAUACC-3’....
2.) Consider the following RNA sequence, which represents the beginning of an open reading frame: 5’-AUGGGACUAGAUACC-3’. Examine each of the sequences below, describe the change to the sequence, and state whether it represents a silent, missense, nonsense, or frameshift mutation. If frameshift, be sure to include the consequences of the frameshift (nonsense or massive missense). Use the codon table. a) 5’-AUGGGUCUAGAUACC-3’ b) 5’-AUGCGACUAGAUACC-3’ c) 5’-AUGGGACUAGUUACC-3’ d) 5’AUGGGACUAAGAUACC-3’ 3. Using a couple of sentences each, describe the function of each of...
5.Consider again the picture you selected in question #3. What’s attached to the 5’ end of...
5.Consider again the picture you selected in question #3. What’s attached to the 5’ end of this molecule? (BOLD the correct answer)    A phosphate group    OR    An OH group (which is attached to the ribose sugar) 6.Consider again the picture you selected in question #3. The way it’s drawn on this page, the bottom end of this molecule is considered to be the…(BOLD the correct answer)             3’ end      OR      5’ end
Which of the following contains 3 different RNA molecules?
 Which of the following contains 3 different RNA molecules? (a) the prokaryote 30S ribosomal subunit (b) the eukaryote 40S ribosomal subunit (c) the prokaryote 50S ribosomal subunit (d) the eukaryote 60S ribosomal subunit (e) all of the above
How do you interpret the statement "Theory must be a guide to practice, not an end...
How do you interpret the statement "Theory must be a guide to practice, not an end in itself"? Defend your answer
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT