If the DNA sequence in the question above is at the BEGINNING of a gene, what...

If the DNA sequence in the question above is at the BEGINNING of a gene, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question.

asparagine, alanine

methionine, glutamine

leucine, alanine

alanine, lysine

methionine, asparagine

Solutions

Expert Solution

Ans: The sequence is not given in the question, so i'm considering a sequence just to explain the question.

So as we all know that DNA is double stranded and during transcription one of its strand is used as template and the other one is used as coding strand. Template strand serves as a template for synthesis of a complementary RNA transcript and Coding strand is identical to the RNA transcript in sequence, except that it has uracil (U) bases in place of thymine (T) bases.

Now lets take the sequence and consider that it is the template strand:

CCC GGA TAC GTT ACA TGG TAT GGC TTC GTC; So the coding strand is GGG CCT ATG CAA TGT ACC ATA CCG AAG CAG. Now the RNA transcript is identical to this coding strand except in the place of Thymine(T) RNA trasncript has Uracil(U). So RNA transcript is GGG CCU AUG CAA UGU ACC AUA CCG AAG CAG and as we all know that translation starts from the initiation codon AUG and AUG codon codes for Methionine. Now the second codon after initiation codon is CAA which encode Glutamine amino acid.

So, the first 2 amino acids joined at the ribosome is Methionine and Glutamine.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3...

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3 C θ G 1/3 T 1/3 - θ In an experiment, the number of observed bases that are “A” or “C” in a gene sequence is x, and the number of observed bases that are “G” or “T” is y. The EM method is used to find the best value for the parameter θ. Describe the Expectation step for computing the expected numbers of...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): 5’-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3’ Consider the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA that you determined in the previous question. What is the amino acid sequence of the polypeptide encoded by this mRNA? You must show and explain all work/evidence to receive credit.

The following DNA coding sequence is at the beginning of a coding region of the wildtype...

The following DNA coding sequence is at the beginning of a coding region of the wildtype MCB gene (wildtype allele) DNA 5’ C A T G A A A T G G* G A G C C T G A A G G A 3’ (mutant allele) DNA 5’ C A T G A A A T G A* G A G C C T G A A G G A 3’ There has been a base change mutation at...

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and...

DNA sequence of wild type gene A and a mutant is shown below. 1. Transcribe and translate the wild type and mutant proteins. 2. Classify the type(s) of mutation(s) in gene A the mutant has. 3. Design a primer pair to generate a PCR fragment of any size from the wild type sequence. Write the primer pair and mark the 5’ and 3’ of each primer sequence. wild-type gene 5’ TAG|ACC|ATG|CCA|GTA|AAT|TTA|CGA|TGA|CA 3’ 3’ ATC|TGG|TAC|GGT|CAT|TTA|AAT|GCT|ACT|GT 5’ mutant 2 5’ TAG|ACC|ATG|CCA|GTA|AAT|ATG|TTA|CGA|TGA|CA 3’ 3’ ATC|GGG|TAC|GGT|CAT|TTA|TAC|AAT|GCT|ACT|GT...

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

The following is a portion of the non-template DNA sequence from the human ras gene. Answer...

The following is a portion of the non-template DNA sequence from the human ras gene. Answer the following questions about this gene and the effects of gene changes to the specified mutant sequence (mutation in BOLD). Normal human ras: 5’-acatgactgaatataaacttgtggtagttggagctggt-3’ Mutant human ras: 5’-acatgactgaacataaacttgtggtagttggagctggt-3’ a. (4) What is the normal human Ras amino acid sequence from this portion of the gene, starting with the first start codon? b. (2) Which amino acid from the normal sequence is mutated, and what...

• What is a structural gene? • What is a regulatory sequence? • What is a...

• What is a structural gene? • What is a regulatory sequence? • What is a promoter? What is an operator? • What are the regulatory GENES and their promoters? What is a repressor? Are these genes considered part of the operon? Are they always located next to the genes they control?

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) •...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) • Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence. • Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence. 5’ 3’ GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC 3’ 5’ CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

Subjects