1. In DNA, the type of bonds that form the base pairing between the bases, A::T...

1. In DNA, the type of bonds that form the base pairing between the bases, A::T and C::G are?

a. ionic bonds

b. peptide bonds

c. H-bonds

d. covalent bonds

2. If you wanted to build a short DNA strand, which of the following nucleotides would you not use?

Select one:

a. dTTP

b. dUTP

c. dGTP

d. dCTP

Expert Solution

1. Option C is correct : Hydrogen bonds

In DNA, nucleotides are paired to each other via hydrogen bonds in a complementary manner. Adenine pairs with thymine by two hydrogen bonds and cytosine binds with guanine by three hydrogen bonds.These hydrogen bonds function in maintaining the double helical structure of DNA.

2. Option b is correct : dUTP (deoxyuridine triphosphate)

DNA is composed of four nitrogenous bases which are adenine, thymine, guanine and cytosine. During DNA synthesis, these bases are incorporated inside the double helix by DNA polymerase using substrates such as dATP (for adenine), dTTP (for thymine), dGTP (guanine) and dCTP (for cytosine). dUTP resembles UTP (uracil triphosphate) which is required for RNA synthesis. dUTP acts as a substrate for synthesizing various enzymes like nucleoside diphosphate kinase 1, uridine-cytidine kinase, nucleodide diphosphate kinase B.

gladiator answered 1 year ago

10.Which base pairing is incorrect for DNA replication (not protein synthesis) a. A-T B. T-A C....

10.Which base pairing is incorrect for DNA replication (not protein synthesis) a. A-T B. T-A C. G-C D. U-T 12.Cancer results from unchecked a. Mitosis b. Meiosis c. Homeostasis d. Complementarity 22. Which of the following is true about aerobic cellular respiration? a. it occurs in both plant and animal cells b. It is a catabolic reaction c. Sugar ( in the presence of oxygen) is broken down into carbon dioxide and water, releasing energy. d. all of the above...

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or...

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding?Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single...

7. Describe in detail the forces which contribute to base pairing and base stacking in DNA.

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3...

Suppose the DNA bases in a gene sequence follow the distribution: DNA base Probability A 1/3 C θ G 1/3 T 1/3 - θ In an experiment, the number of observed bases that are “A” or “C” in a gene sequence is x, and the number of observed bases that are “G” or “T” is y. The EM method is used to find the best value for the parameter θ. Describe the Expectation step for computing the expected numbers of...

What would happen if there were an error in the DNA complementary base pairing? explain.

Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids...

Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids this gene codes for, in the following DNA strand1 : ATG _____ _____ _____ _____ _____ CGC DNA strand 2 : *_____ GCC _____ _____ _____ AGT _____ mRNA : _____ _____ AUA _____ UUU _____ _____ tRNA : _____ _____ _____ UAC _____ _____ _____ Amino acids : ______ ______ _____ _____ ______ ______ ______ (Remember which type of RNA actually...

A DNA string is a sequence of the bases a, c, g, and t in any...

A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...

1. The enzyme responsible for recognizing damaged bases in DNA is __________ . a. DNA glycosylase...

1. The enzyme responsible for recognizing damaged bases in DNA is __________ . a. DNA glycosylase b. DNA polymerase c.DNA ligase exonuclease 2. What term is used to describe a species which affects the functioning of an allosteric enzyme? a. controller b. inhibitor c. regulator d. alloster 3 Which of the following statements is correct? a. adenine and guanine are both pyrimidines b. adenine and guanine are both purines c. adenine is a purine and guanine is a pyrimidine d....

Whereas ionic bonds form a(n)_, covalent bonds between atoms form a(n)__.

Whereas ionic bonds form a(n)_________, covalent bonds between atoms form a(n)__________. These covalent bonds have a charachteristic bond ______________and become stronger and more rigid when two pairs of electrons are shared in a(n) __________. Equal sharing of electrongs yields a(n)_____________ covalent bond. If one atom participating in the bond has a stronger affinity for the electron, this produces a partial negative charge on one atom and a partial positive charge on the other. These_______ covalent bonds should not be confused...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues and 14,000 G+C residues. Analysis of one of the strands of DNA showed that it had 3,000 A and 4,000 C residues. What is the number of T and G base residues on this strand?

Question