Question

In: Economics

PLEASE explain why each answer of the following questions is correct, I need to understand it...

PLEASE explain why each answer of the following questions is correct, I need to understand it .

1)Economy is at its long run equilibrium. Assuming all else equal, stock market collapses and consumer sentiment level deteriorates. Which of the following is incorrect?

A. In short run, output level decreases and price level decreases.

B. In long run, output level is back to its long run output level.

C. In short run, short run aggregate supply decrease.

D. In long run, economy self corrects as short run aggregate supply increases.

2. Economy is at its long run equilibrium.

Thanks to a favorable business environment, stock market is booming so is housing market. What would be the price level and output in the long run? (assuming all else equal)

A. Price level is higher than its long run level, and output level is higher than its long run level.

B. Price level is higher than its long run level, but output is at its long run output.

C. Price level is at its initial level, but output level is lower than its long run output.

D. Price level is lower than its initial level, and output is higher than its long run level.

3. Economy is at its long run equilibrium. Assuming all else equal, thanks to a strong Chinese demand of U.S. goods, exports in U.S. economy has increased. Which of the following is correct?

A. SRAS increases.

B. LRAS increases.

C. In short run, aggregate price level decrease.

D. In long run, aggregate output level is at its long run output.

4. Economy is at its long run equilibrium. Suppose stock market crashes, housing price goes down, business confidence decreases and foreign market GDP number goes down. (Assuming all else equal) Which of the following is correct?

A. Short run aggregate supply decreases in short run.

B. In long run, long run aggregate supply decrease.

C. In short run, aggregate price level increases.

D. In long run, aggregate price level is lower than its initial level.

5.Economy was at its long run equilibrium. Assuming all else equal, there was an increase in exports. Which of the following is incorrect?

A. Classical economists would say that the price level will be higher than before, and output level will be at its potential output.

B. Keynesian economists would say that both the price level and output will be higher than before.

C. Keynesian economists would suggests stabilization policy to close a positive output gap.

D. Classical economists would suggests an increase in tax to close a positive output gap.

Please explain the reason for each answer, I will give great review!

Solutions

Expert Solution

1.
Correct Answer:
C

When the stock market collapses and consumer sentiments decreases, then aggregate demand shifts to the left. It causes the output to decrease and price to decrease as well. After this, the short run aggregate supply, will increase and shift to the right. It will push the real output to be at the level of potential output, but at the lower price.
So, in short run, aggregate supply curve increases.

2.
Correct Answer:
B

In the long run, only nominal variable such as price changes, but real GDP or output does not change. When the stock market is booming, then AD curve shifts to the right, increasing output and price. It causes the demand pull inflation and SRAS curve shifts to the right. It makes economy back to the potential output level, but at the higher price.

3.
Correct Answer:
D

Due to increase in the export, the AD will shift to the right, but it will increase the price. As a result the SRAS will shift back to the left. It will bring back the economy at long run output level, but at higher prices.

4.
Correct Answer:
D

In the long run, output level reaches back to the potential output level. But, it happens at the reduced price level. Initially, AD curve shifts to the left and price and output decreases. It also reduces the wages. As a result, SRAS shift to the right and achieves potential output, but at the lower price.


Pl. repost the other questions for their proper answers!


Related Solutions

Please answer the following questions. 1. Please explain why we need image rejection filter or image...
Please answer the following questions. 1. Please explain why we need image rejection filter or image rejection mixer and when we need with detail explanation. 2. Please introduce a couple of methods to remove image signals.
Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate...
Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community b) agency problem is that managers may act in their own interests and not on behalf of stockholders. c) Corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community....
please answer all 4 questions. i don't need a long answer. please explain them briefly and...
please answer all 4 questions. i don't need a long answer. please explain them briefly and correctly. Thank you in advance. 1. What does the term qualitative analysis mean? 2. The confirmatory reactions that identify nitrate and nitrite both produce brown NO2 gas. What criterion will you use to determine which anion produced the gas? 3. The confirmation reaction for the halides involves the addition of chlorine water. Describe how you will know which, if any, of the anions is...
I need an answer to all three questions, please. Q1: Which of the following was not...
I need an answer to all three questions, please. Q1: Which of the following was not a policy response to the Economic crisis associated with the COVID-19 Crisis? Select one: a. The Fed lowered the policy rate by roughly 1.5 percentage points to nearly zero. b. The U.S. Congress passed a roughly $3 Trillion economic stimulus package. c. The Commonwealth of Massachusetts relaxed the balanced budget rule in the State Constitution. d. The Fed introduced facilities to keep markets liquid...
please answer all 4 questions. I need brief and correct answers. thank you in advance. 1....
please answer all 4 questions. I need brief and correct answers. thank you in advance. 1. Why is it important to mix the solutions after adding the reagents? How is mixing done in this experiment? 2. What is the reason for rinsing the precipitates before further testing? 3. What two things are extremely important to remember when centrifuging? 4. Why is it possible to separate Cu+2 from Al+3 and Fe+3 with NH4OH but not with NaOH? (Hint, consider solubility properties.)
Please, I need a correct answer and clear explanation. Thank you, (Determine expenses) The following are...
Please, I need a correct answer and clear explanation. Thank you, (Determine expenses) The following are activities in a three-month period for Basiliadis Company: 1.A new lease for the business premises goes into effect on October 1 and increases the rent from $1,000 to $1,150 per month. The rent for the next month is always prepaid on the last day of the current month. Accordingly, rent of $1,000 was paid on August 31, and $1,150 was paid on September 30...
Please, I need a correct answer and clear explanation. Thanks, Explain how a prepaid expense differs...
Please, I need a correct answer and clear explanation. Thanks, Explain how a prepaid expense differs from an accrued expense.
Correct answer is given, please explain why for each. Concept Question 1 – A rock is...
Correct answer is given, please explain why for each. Concept Question 1 – A rock is thrown straight up from the surface of the earth. Ignoring air resistance, which of the following statements is correct as the rock moves upward? a) The total energy of the rock increases. b) Both the kinetic energy and the gravitational potential energy of the rock remain the same. c) Both the gravitational potential energy and the total energy of the rock increase. d) Both...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...
For each of the following answer choices explain why the specific choice is incorrect or correct....
For each of the following answer choices explain why the specific choice is incorrect or correct. Give a detailed explanation with relevant outside information for your justification of a choice of falsification. Each falsification or justification should be no less than a paragraph each. The energy released during oxidation of glucose to CO2 and water is high and can produce many molecules of NADH. Why then are only few molecules of NADH made during glycolysis when it appears that many...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT