I know the answer for A is 155 and B is 102, please show work how...

I know the answer for A is 155 and B is 102, please show work how to to get there especially after finding 13(208)- 53 (51) for A. And For b same thing please show work step by step.

A) Find the multiplicative inverse of 51 (mod 208). justify your answer and leave it as number between 0 and 207.

B) solve the following linear congruence. Justify your work and leave your answer as a number between 0 and 207 : 51x - 1 = 1 (mod 208)

Expert Solution

Colby Messinger answered 2 years ago

Please show work for how you get answers for a and b. FOR A the answer...

Please show work for how you get answers for a and b. FOR A the answer is -46,247.78 For B the answer is 930,668. Lease or Buy Wolfson Corporation has decided to purchase a new machine that costs $3.2 million. The machine will be depreciated on a straight-line basis and will be worthless after four years. The corporate tax rate is 35 percent. The Sur Bank has offered Wolfson a four-year loan for $3.2 million. The repayment schedule is four...

please answer to Part 1 b please show your work how to get that number and...

please answer to Part 1 b please show your work how to get that number and no hand writing plz thanks Waterways Corporation is considering various business opportunities. It wants to make the best use of its production facilities to maximize income. This problem asks you to help Waterways do incremental analysis on these various opportunities. Part 1 Waterways mass-produces a special connector unit that it normally sells for $3.90. It sells approximately 35,000 of these units each year. The...

I do not know how to answer part b. Can you show me how to conduct...

I do not know how to answer part b. Can you show me how to conduct a hypothesis test for this problem? As I know the answer for part a is 0.4 Let X be the weight of flour (in g) contained in a 1kg bag of flour made by a certain company and assume X~U(980,1030). a) What is the probability that the bag of flour has less than 1kg of flour in it? b) The owner of this factory...

(Please show work so I can understand how you got to the answer - Thank you...

(Please show work so I can understand how you got to the answer - Thank you very much ) Via Gelato is a popular neighborhood gelato shop. The company has provided the following data concerning its operations: Fixed Element per Month Variable Element per Liter Actual Total for June Revenue $ 13.00 $ 72,540 Raw materials $ 4.75 $ 30,330 Wages $ 5,700 $ 1.50 $ 14,560 Utilities $ 1,730 $ 0.30 $ 3,800 Rent $ 2,700 $ 2,700 Insurance...

Please show how work on how you got this answer. Q1: What will be the pressure...

Please show how work on how you got this answer. Q1: What will be the pressure (in mmHg) inside of a 50.0 L container that holds 7.00 moles of hydrogen gas at 0.0 C? Q2: Oxygen Gass is produced for use in a small-scale experiment by the catalytic decomposition of hydrogen peroxide: 2 H2O2 (aq) -------------------> 2 H2O (l) + O2 (g) If 50.0 mL of a 1.00 M solution of H2O2 completely decomposes and what volume of dry oxygen...

Please show the work for how to get the answer. Thank you in advance. Assume that...

Please show the work for how to get the answer. Thank you in advance. Assume that all of the mass of a bicycle wheel is concentrated at its rim. Such a wheel of mass 1.2 kg and radius 30 cm starts from rest at the top of a hill 100 m long and inclined at 20� to the horizontal. What will be the speed of the wheel at the bottom of the hill if it rolls without slipping? (Answer: 15...

please answer to Part 1 c please show your work how to get that number and...

please answer to Part 1 c please show your work how to get that number and no hand writing plz thanks Waterways Corporation is considering various business opportunities. It wants to make the best use of its production facilities to maximize income. This problem asks you to help Waterways do incremental analysis on these various opportunities. Part 1 Waterways mass-produces a special connector unit that it normally sells for $3.90. It sells approximately 35,000 of these units each year. The...

Please Use Excel to Show All Work, I will like your answer :) 15.54 The Tire...

Please Use Excel to Show All Work, I will like your answer :) 15.54 The Tire Rack, America’s leading online distributor of tires and wheels, conducts extensive testing to provide customers with products that are right for their vehicle, driving style, and driving conditions. In addition, the Tire Rack maintains an independent consumer survey to help drivers help each other by sharing their long-term tire experiences. The following data show survey ratings (1 to 10 scale with 10 the highest...

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...

Please only show me the graphs I know the answers to below problems. I don't know...

Please only show me the graphs I know the answers to below problems. I don't know how to do the graphs correctly. 1. A radar unit is used to measure speeds of cars on a motorway. The speeds are normally distributed with a mean of 90 km/hr and a standard deviation of 10 km/hr. What is the probability that a car picked at random is travelling at more than 100 km/hr? 2. For a certain type of computers, the length...

Question