Question

In: Statistics and Probability

If you keep giving the correct answer and didn't explain it goes to trash A committee...

If you keep giving the correct answer and didn't explain it goes to trash

A committee of 3 has to be chosen randomly from a group of 40 people . there are 40 people total are from 4 different countries. 10 from each country. What is the probability that the members of the committee are all from different country?

Why my answer is not correct? (4C1*10C1*3C1*10C1*2C1*10C1/ 40C3) you need to tell me what is wrong with my answer if you don't answer why my answer is not correct don't waste your time to answer, it will be reported

Solutions

Expert Solution

Let the four countries are A, B, C, D.

So the selection of three members from different country will be ABC, ABD, BCD, CDA

P(the members of the committee are all from different country) = 4 * (10C1 * 10C1 * 10C1)/40C3

                                                                                                   = 4 * (10 * 10 * 10) * (3! * 37!)/40!

                                                                                                   = 0.4049

                                                                                                  

orchestra answered 2 years ago
Next > < Previous

Related Solutions

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...
Explain giving examples why it is important to keep current cost in line with planned cost....
Explain giving examples why it is important to keep current cost in line with planned cost. Using examples where possible, describe the process of job costing used in non-profit organizations. Why is it important to establish appropriate cost pools? An electrical component manufacturer has selected direct labour hours as an application base. They plan to sell 35,000 units of copper tubing although the factory has the capacity to produce 40,000 units under normal circumstances.        Overheads are estimated as follows:...
Select the correct answer: The Fed’s main policy-making committee is the (Board of Governors; Federal Open...
Select the correct answer: The Fed’s main policy-making committee is the (Board of Governors; Federal Open Market Committee). The Fed sets the minimum percentage of deposits that must be held as reserves, which is called the (discount rate; required reserve ratio). The currency in a bank’s vault is part of the bank’s (reserves; loans). The purchase or sale of government securities by the Federal Reserve is an (unit of account; open market operation). Along the aggregate (supply curve, demand curve)...
All of the following statements are false. Please determine the error and rewrite teh answer giving completely correct information.
All of the following statements are false. Please determine the error and rewrite teh answer giving completely correct information.1. To calculate a syringe dose, read the fluid level from the tip of the plunger just above the calibration mark.2. A tuberculin syringe is calibrated in units only.3. Usually only solutions of 2 to 3ml are given subcutaneously.4. The most common insulin syringe is called the U-50.5. Heparin is normally given using an insulin syringe.6. The typical intramuscular syringe holds 100...
Underline all the correct answers. Explain why an answer is correct or why it is wrong....
Underline all the correct answers. Explain why an answer is correct or why it is wrong. You are supposed to select all of the correct answers (1-6) for each roman numeral (I-III) --Please justify/explain answers thoroughly-- Problem 7. If photons with energy of 1.7 eV was applied to A Si Wafer is at 300k (Eg for Si =1.12eV), the valence and conduction band are (I) 1-      Both are completely empty 2-      Both are completely filled. 3-      Both are partially empty....
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is correct. Identify why the other options are not correct. One of the major roles of the TCA cycle is to generate reduced cofactors for ATP production from oxidative phosphorylation. The compound donating the net eight electrons to the cofactors is which one of the following? Pyruvate Acetyl-CoA Lactate Oxaloacetate Phosphoenolpyruvate
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is correct. Identify why the other options are not correct. Which one of the following correctly describes how the acetyl-CoA is metabolized in the mitochondria? One molecule of acetyl-CoA produces two molecules of CO2, three molecules of NADH, one molecule of FAD(2H) and one molecule of ATP. All of the energy for high-energy phosphate bonds is derived from oxidative phosphorylation. NAD+ is the only electron acceptor in the cycle. Substrate-level phosphorylation generates...
Select the correct answer or answers for each and explain: 1. When you take a book...
Select the correct answer or answers for each and explain: 1. When you take a book from your desk and put it up on a shelf above you the work done on the book depends on: (1) how fast you moved the book, (ii) depends on whether you moved it straight up or along an arched path, (iii) depends on how high the shelf is, (iv) depends on the mass of the book. d. A 80-kg baseball player while running...
CHOOSE THE CORRECT ANSWER AND EXPLAIN FOR EACH OPTION WHY YOU DID NOT CHOOSE THAT OPTION....
CHOOSE THE CORRECT ANSWER AND EXPLAIN FOR EACH OPTION WHY YOU DID NOT CHOOSE THAT OPTION. Arrange the following events in steroid function in chronological order. Number each statement from 1-5. _____Level of estradiol increases _____Decrease in the thickening of uterine lining _____Ovulation triggered by luteinizing hormone _____If no ovum is fertilized, progesterone and estradiol production stops _____Bleeding due to sloughed off uterine lining a. 3, 2, 4, 1, 5 b. 3, 1, 4, 2, 5 c. 1, 4, 3,...
Please explain why the correct answer is correct A bank reconciliation reconciles the bank statement with...
Please explain why the correct answer is correct A bank reconciliation reconciles the bank statement with the company's: Correct Answer: B. Cash account in the balance sheet. A corporation received $2,000 for interest earned on a note for a loan made to an employee in the current year. How would this transaction be recorded and what type of activity would this be classified under? Selected Answer: C. Debit Accounts Receivable $2,000, credit Interest Revenue $2,000; Financing Correct Answer: A. Debit...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT