Question
In: Statistics and Probability
If you keep giving the correct answer and didn't explain it goes to trash A committee...
If you keep giving the correct answer and didn't explain it goes to trash
A committee of 3 has to be chosen randomly from a group of 40 people . there are 40 people total are from 4 different countries. 10 from each country. What is the probability that the members of the committee are all from different country?
Why my answer is not correct? (4C1*10C1*3C1*10C1*2C1*10C1/ 40C3) you need to tell me what is wrong with my answer if you don't answer why my answer is not correct don't waste your time to answer, it will be reported
Solutions
Expert Solution
Let the four countries are A, B, C, D.
So the selection of three members from different country will be ABC, ABD, BCD, CDA
P(the members of the committee are all from different country) = 4 * (10C1 * 10C1 * 10C1)/40C3
= 4 * (10 * 10 * 10) * (3! * 37!)/40!
= 0.4049
orchestra answered 2 years agoRelated Solutions
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the
5'---->3' it goes reverse
and 3'-->5' it goes forward.......I got lost after this.
Please explain. Will give a thumbs up.
-----
Which of the following sets of primers could you use to amplify
the target DNA sequence below, which is part of the last
protein-coding exon of the gene involved in cystic fibrosis?
5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’
3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’
a) 5’ GGAAAATTCAGATCTTAG...
Explain giving examples why it is important to keep current cost in line with planned cost....
Explain giving examples why it is important to keep current cost
in line with planned cost. Using examples where possible, describe
the process of job costing used in non-profit
organizations.
Why is it important to establish appropriate cost pools?
An electrical component manufacturer has selected direct labour
hours as an application base. They plan to sell 35,000 units of
copper tubing although the factory has the capacity to produce
40,000 units under normal circumstances.
Overheads are
estimated as follows:...
Select the correct answer: The Fed’s main policy-making committee is the (Board of Governors; Federal Open...
Select the correct answer:
The Fed’s main
policy-making committee is the (Board of Governors; Federal
Open Market Committee).
The Fed sets the
minimum percentage of deposits that must be held as reserves, which
is called the (discount rate; required reserve
ratio).
The currency in a
bank’s vault is part of the bank’s (reserves;
loans).
The purchase or sale
of government securities by the Federal Reserve is an (unit
of account; open market operation).
Along the aggregate
(supply curve, demand curve)...
All of the following statements are false. Please determine the error and rewrite teh answer giving completely correct information.
All of the following statements are false. Please determine the
error and rewrite teh answer giving completely correct
information.1. To calculate a syringe dose, read the fluid level from the
tip of the plunger just above the calibration mark.2. A tuberculin syringe is calibrated in units only.3. Usually only solutions of 2 to 3ml are given
subcutaneously.4. The most common insulin syringe is called the U-50.5. Heparin is normally given using an insulin syringe.6. The typical intramuscular syringe holds 100...
Underline all the correct answers. Explain why an answer is correct or why it is wrong....
Underline all the
correct answers. Explain why an answer is correct or why it is
wrong. You are supposed to select all of the
correct answers (1-6) for each roman numeral (I-III)
--Please
justify/explain answers thoroughly--
Problem 7. If photons with energy of 1.7 eV was applied
to A Si Wafer is at 300k (Eg for Si =1.12eV), the
valence and conduction band are
(I)
1- Both are completely empty
2- Both are completely filled.
3- Both are partially empty....
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is
correct. Identify why the other options are not
correct.
One of the major roles of the TCA cycle is to generate
reduced cofactors for ATP production from oxidative
phosphorylation. The compound donating the net eight electrons to
the cofactors is which one of the following?
Pyruvate
Acetyl-CoA
Lactate
Oxaloacetate
Phosphoenolpyruvate
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is
correct. Identify why the other options are not
correct.
Which one of the following correctly describes how the
acetyl-CoA is metabolized in the mitochondria?
One molecule of acetyl-CoA produces two molecules of
CO2, three molecules of NADH, one molecule of FAD(2H)
and one molecule of ATP.
All of the energy for high-energy phosphate bonds is derived
from oxidative phosphorylation.
NAD+ is the only electron acceptor in the
cycle.
Substrate-level phosphorylation generates...
Select the correct answer or answers for each and explain: 1. When you take a book...
Select the correct answer or answers for each and explain:
1. When you take a book from your desk and put it up on a shelf
above you the work done on the book depends on: (1) how fast you
moved the book, (ii) depends on whether you moved it straight up or
along an arched path, (iii) depends on how high the shelf is, (iv)
depends on the mass of the book. d. A 80-kg baseball player while
running...
CHOOSE THE CORRECT ANSWER AND EXPLAIN FOR EACH OPTION WHY YOU DID NOT CHOOSE THAT OPTION....
CHOOSE THE CORRECT ANSWER AND EXPLAIN FOR EACH OPTION WHY YOU
DID NOT CHOOSE THAT OPTION.
Arrange the following events in steroid function in
chronological order. Number each statement
from 1-5.
_____Level of estradiol increases
_____Decrease in the thickening of uterine lining
_____Ovulation triggered by luteinizing hormone
_____If no ovum is fertilized, progesterone and estradiol
production stops
_____Bleeding due to sloughed off uterine lining
a. 3, 2, 4, 1, 5
b. 3, 1, 4, 2, 5
c. 1, 4, 3,...
Please explain why the correct answer is correct A bank reconciliation reconciles the bank statement with...
Please explain why the correct answer is correct
A bank reconciliation reconciles the bank statement with the
company's:
Correct Answer:
B.
Cash account in the balance sheet.
A corporation received $2,000 for interest
earned on a note for a loan made to an employee in the current
year. How would this transaction be recorded and what type of
activity would this be classified under?
Selected Answer:
C.
Debit Accounts Receivable $2,000, credit Interest Revenue
$2,000; Financing
Correct Answer:
A.
Debit...
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Consider a buffer system consisting of Benzoic acid (pKa = 4.20) and sodium benzoate, a) Would...
- Decision Variables S T Minimize 1.8S + 2.20T Subject to: Potassium 5S + 8T >= 200...
- A neurologist needs to counsel a stroke victim and her husband about possible outcomes, treatment options,...
- Case Study: Personal Beliefs in the Workplace Don Shakow was a prominent professional who worked in...
- 1: Competency framework usage is the modern best practice in management. What is meant by competency...
- A 19.34 g mixture of sugar (C12H22O11) and table salt (NaCl) is dissolved in 231 g...
- Young and Company claims that its pressurized diving bell will, on average, maintain its integrity to...
ADVERTISEMENT