Question

In: Economics

IMPORTANT: I know the answer is "C". However, I don't know why. Could you please explain...

IMPORTANT: I know the answer is "C". However, I don't know why. Could you please explain why? Thank you

A linear total cost curve that passes through the origin implies that

a.         average cost is constant and marginal cost is variable.

b.         average cost is variable and marginal cost is constant.

            c.         average and marginal costs are constant and equal.

            d.         you need more information to answer question.

Solutions

Expert Solution

A linear total cost curve passing through the origin implies zero fixes costs. This is because Total Cost (TC) is the sum of Fixed Costs (FC) and Variable Costs (VC). Costs cannot be negative. So, the total cost curve can pass through origin only when FC=0.

If FC=0, we have

which means that for zero output produced, we have zero total cost. The total Cost rises with each additional unit of output produced. Let us now consider a linear Total Cost curve that passes through the origin (intercept term = 0). We thus define the linear function as:

We now define Average Cost as the Total Cost per unit of output, that is

Similarly, we define Marginal cost as the cost of producing an additional unit of output.

Also, we see that

Thus, we see that a linear Total Cost Curve that passes through the origin implies that

(c) Average and Marginal Costs are constant and equal.


Related Solutions

C# please answer if you know, don't copy others answers, Prime factors are the combination of...
C# please answer if you know, don't copy others answers, Prime factors are the combination of the smallest prime numbers, that, when multiplied together, will produce the original number. Consider the following example: Prime factors of 4 are: 2 x 2 Prime factors of 7 are: 7 Prime factors of 30 are: 2 x 3 x 5 Prime factors of 40 are: 2 x 2 x 2 x 5 Prime factors of 50 are: 2 x 5 x 5 Create...
ANSWER ALL 11 QUESTIONS PLEASE DON'T !!! ANSWER IF YOU DON'T KNOW ALL THE ANSWERS THANK...
ANSWER ALL 11 QUESTIONS PLEASE DON'T !!! ANSWER IF YOU DON'T KNOW ALL THE ANSWERS THANK YOU. 1. What things affect airflow and which one is the most important? 2. Explain how an asthma attack could create a life-threatening condition? 3. Explain how emphysema is associated with expiratory flow limitation and its consequence on the person’s health 4. What are the muscles of inspiration? 5. What role do these muscles perform? 6. What are the primary sources of resistance for...
Database Normalization Please if you don't know the answer don't comment as "Need More Information." Please...
Database Normalization Please if you don't know the answer don't comment as "Need More Information." Please answer it in a table form with the data included as per table A and table B. Introduction: This lab is designed to help you with practicing normalization concepts implementation. Submission: After finishing the task below, convert the word file to a PDF document and submit it to Brightspace. Task: Using this file, normalize the following tables to be in the third normal form....
I need a full answer ...not a part.. please and you don't have to explain just...
I need a full answer ...not a part.. please and you don't have to explain just give me a answer plesase.. question 1 . Match the following, each choice is used once. 1. Levering System a. long or irregular bones b. synovial joint c. how things move d. muscle power e .object to be moved 2. Pivot (Fulcrum) a. long or irregular bones b. synovial joint c. how things move d. muscle power e .object to be moved 3. Effort...
Database Normalization Please if you don't know the answer don't comment as "Need More Information." Introduction:...
Database Normalization Please if you don't know the answer don't comment as "Need More Information." Introduction: This lab is designed to help you with practicing normalization concepts implementation. Submission: After finishing the task below, convert the word file to a PDF document and submit it to Brightspace. Task: Using this file, normalize the following tables to be in the third normal form. Remember to consider having the data when you do the normalization. Course_Title Course_Credit_Hours Professor_ID Professor_Name First_day_work Professor Specialization_ID...
//Trying to get this code with JavaScript. I could partition the subarrays, but I don't know...
//Trying to get this code with JavaScript. I could partition the subarrays, but I don't know how to check for unique elements Given an array of integers check if it is possible to partition the array into some number of subsequences of length k each, such that: Each element in the array occurs in exactly one subsequence For each subsequence, all numbers are distinct. Elements in the array having the same value must be in different subsequences If it is...
Why is it important to know PCAOB law? Please explain in detail
Why is it important to know PCAOB law? Please explain in detail
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...
If you could explain this and answer it, I would greatly appreciate it. C. Use Excel...
If you could explain this and answer it, I would greatly appreciate it. C. Use Excel (or equivalent application) to determine how long it will take for an investment to triple in value at interest rates of 1%, 5%, 10%, 15%, 20%, and 25%. Can you determine an approximate “Rule” for how to quickly calculate how long it takes for an investment to triple in value?
Please answer all If you can't answer all then please don't answer just one question. i...
Please answer all If you can't answer all then please don't answer just one question. i need all 2. You would like to buy a house in in 16 years and estimate that you will need a deposit of $73,014. You plan to make bi-weekly deposits into an account that you hope will earn 7.05%. How much do you have to deposit every two weeks? 3. You have accumulated $1,085.55 in debt by buying things on Amazon during quarantine.  The minimum...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT