1) a mutation occurs in which an AAA codon, which signifies lysine, into AGA which signifies...

1) a mutation occurs in which an AAA codon, which signifies lysine, into AGA which signifies a chemically similar amino acid arginine. This is an example of a ____ mutation?

a) conservative nonsynomous b) frameshift c) nonsense d) conditional e) silent

It has to be neutral mutation, but the option for neutral is not given... would it be conditional?

2) Which of the following types of inheritance could account for an affected male having all affected daugters but no affected sons?

a) autosomal recessive b) autosomal dominant c) Y-linked d) X-linked recessive e) X-linked dominant

it has to be dominant... so its either b or e?

3) The site where RNA polymerase binds to the DNA template is called the ____ sequence.

	a)	enhancer
	b)	promoter
	c)	domain
	d)	terminator
	e)	reading frame

Expert Solution

1.ANSWER: a)

A nonsynonymous substitution results in a change in amino acid that may be arbitrarily further classified as conservative.

2. e)

All daughters of an affected father will also be affected but none of his sons will be affected.

3. promoter

the binding of RNA polymerase and the initiation of transcription. Only after certain transcription factors are attached to the promoter does the RNA polymerase bind to it. The completed assembly of transcription factors and RNA polymerase bind to the promoter, forming a transcription initiation complex.

gladiator answered 2 years ago

What is a codon? What is silent mutation?

19.A mutation that changes an amino acid-coding codon to a stop codon is classified as: A...

19.A mutation that changes an amino acid-coding codon to a stop codon is classified as: A – Silent B – Missense C – Nonsense D – Neutral 20.Spontaneous mutations can arise from: A – All answers are correct B – A base gets damaged C – DNA polymerase inserts an incorrect nucleotide D – A loop occurs during replication 21.DNA Repair Systems: A – Counteract spontaneous and induced mutations B – Counteract induced mutations only C – Counteract amino acid...

QUESTION 1 A single base change mutation at the third position in a codon for a...

QUESTION 1 A single base change mutation at the third position in a codon for a protein encoding gene would most often cause a ______. ( ) Deletion mutation ( ) Insertion mutation ( ) Nonsense mutation ( ) Silent mutation ( ) Missense mutation 3 points [Save Answer] QUESTION 2 Which of the following correctly ranks a point mutations effect on a protein from most severe mutation to the least? ( ) Missense, silent, nonsense ( ) Silent, nonsense,...

A mutation occurs in a bacterium. Because of this mutation, DNA synthesis occurs at a very...

A mutation occurs in a bacterium. Because of this mutation, DNA synthesis occurs at a very low rate. Upon analysis, it is found to have normal levels of activity of DNA polymerase I and III, DNA gyrase, and ligase. It also makes normal amounts of the wildtype dnaA, dnaB, dnaC, and SSB proteins. The sequence of the OriC (the origin of replication) of its chromosome is found to be normal (wildtype). What defect might account for the abnormally low rate...

A mutation changes the codon CAA to UAA. This is an example of __ A. transition,...

A mutation changes the codon CAA to UAA. This is an example of __ A. transition, nonsense mutations B. transversion, silent mutations C. transition, missense mutations D. transversion, missense mutations E. transition, silent mutations F. transversion, nonsense mutations

1.A single nucleotide mutation in the third position of a codon more often than in the...

1.A single nucleotide mutation in the third position of a codon more often than in the second or first position a) has no effect on the amino acid sequence of the encoded protein. b) alters the reading frame of the mRNA. c) changes an amino acid in the encoded protein. d) introduces a stop codon into the mRNA. 2. The synthesis of new DNA requires the prior formation of RNA oligonucleotides to serve as primers. This latter observation is evidence...

A mouse carries a mutation in somatic cell that changes a lysine codons into a glutamic...

A mouse carries a mutation in somatic cell that changes a lysine codons into a glutamic acid codon. Prior to this mutation the mouse was exposed to X-Ray, UV light, Proflavin, 5-bromouracil and EMS. Which of these agents would be the most likely the cause of the mutation? A. Proflavin B. EMS C. UV light D. 5-bromouracil

1. Please explain how the sequence of events that occurs when a codon that specifies an...

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site. 2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence: 3’–ACTACACGACAGGCATAATT—5’ (DNA Template) a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)...

How would the mutation described above, changing a lysine to an arginine alter the histone code...

How would the mutation described above, changing a lysine to an arginine alter the histone code if this lysine was located on the histone tail? What possible effects could this have? Histone proteins are the most conserved proteins of all eukaryotic proteins. That is to say that there is very little variation in the sequence of amino acids from one species to another. Why do you think this is? Please note that this is a 10 point question, please provide...

A certain genetic mutation occurs in 5% of the population of Whoville. The mutation causes otherwise...

A certain genetic mutation occurs in 5% of the population of Whoville. The mutation causes otherwise normal adult Whos to grow green tail feathers during full moons. A test for this mutation has a sensitivity of 95% and a specificity of 98%. This means that the probability that a Who with the mutation tests positive is 95%, and the probability that a Who without the mutation tests positive is 100%-98%=2%. If a random adult Who is tested for the mutation, then...

Question