a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA...

a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA transcript has an additional 3 bases (NOT a stop) right next to the stop codon (on the 5’ side). Which of the following will be the result?

b) Which of the following are consequences of encoding each amino acid using 3 nucleotides in the Genetic Code? (mre than one)

A. There are three different reading frames in a single-stranded mRNA
B. tRNA anticodons contain 3 nucleotides
C. There are three types of substitutions in protein coding regions (silent, missense, nonsense)
D. Amino acids can be encoded by more than one codon
E. There are three different stop codons
F. Insertion/deletion of non-multiples of 3 bases in ORFs creates a frameshift

Solutions

Expert Solution

a) Insertion of 3 additional bases into a protein-encoding gene right next to the stop codon (on the 5’ side) will result in insertional mutation. The reading frame remains intact after the insertion and translation will most likely run to completion if the inserted nucleotides do not code for a stop codon. However, because of the inserted nucleotides, the finished protein will contain, depending on the size of the insertion, multiple new amino acids that may affect the function of the protein.

b) Options A, D, E and F are correct; There are three reading frames that can be read in this 5'→3' direction, each beginning from a different nucleotide in a triplet. Genetic codon is degenerate and contains wobble base, hence why amino acids can be coded b ymore than one codon. A frameshift mutation is alteration in the normal reading frame of a gene, if the number of inserted nucleotides is not divisible by three, i.e., the number of nucleotides per codon.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.Describe the principles behind and the applications of the following: a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA 3.Describe six differences between DNA replication in bacteria compared with eukaryotes.

Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...

Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. Question 2. You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in...

A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the...

A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the following could be a potential result in meiosis I? 1) Homologous chromosomes will stay together in meiosis I 2) Cohesin will cause sister chromatids to stick together throughout meiosis 3) Sister chromatids will stick together in meiosis I but not in meiosis II 4) Sister chromatids will separate in meiosis I

What is one way that a mutation in the gene encoding for a wild type protein...

What is one way that a mutation in the gene encoding for a wild type protein that generally binds ligands, prevent this protein from ligand binding?

how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to...

how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to the wild type allele ?

A gene is 8,001 nucleotides in length. Studies of this gene show that it encodes a...

A gene is 8,001 nucleotides in length. Studies of this gene show that it encodes a protein only 400 amino acids long – far shorter than the 2,667 amino acids that were expected. This is best explained by the fact: nucleotides often break off and are lost during the transcription process. the genetic code is ambiguous (unclear). in some cases, many nucleotides are used to encode a single amino acid. many of the 8,001 nucleotides of the gene are ultimately...

1. If this insertion is within the coding region of a viral protein, will this insertion...

1. If this insertion is within the coding region of a viral protein, will this insertion result in a frameshift for the rest of the protein? How do you know? 2. The insertion mutation is in a gene that codes for a protein on the surface of the virus, probably a glycoprotein. Assume that this protein is involved in attachment to a host cell. How might a change in a protein involved in attachment change the potential hosts for the...

A frameshift mutation caused by the insertion of a nucleotide in the mRNA with the sequence...

A frameshift mutation caused by the insertion of a nucleotide in the mRNA with the sequence 5' CAT CAT CAT CAT CAT CAT CAT CAT CAT produces an inactive protein. A second frameshift, caused by the deletion of a second nucleotide at some position downstream of the nucleotide insertion, restores the protein function. If the restored protein product contains four amino acids residues that differ from the wild-type protein, what are the maximum and minimum number of nucleotides between the...

You are looking at three alleles of the same gene. The mRNA derived from them is...

You are looking at three alleles of the same gene. The mRNA derived from them is shown below. Allele 1 - AUUCCCAUGACCCCCCCCUGA Allele 2 - CCCAUGACCCAUUAAAUCCCC Allele 3 - AUGACCCAUUAUAUCCCCUGA Rearrange the boxes below to place the alleles in the correct order with respect to the size of the polypeptide encoded. Largest on the top, smallest on the bottom. You may need a codon table to answer this question. You can find one here. Allele 3 Allele 1 Allele 2

Subjects