Question

In: Biology

Come up with an analogy comparing cytogenetic mapping, to genetic mapping, to DNA sequence mapping. Be...

Come up with an analogy comparing cytogenetic mapping, to genetic mapping, to DNA sequence mapping. Be able to describe it. Don't use a country map as an analogy.


an analogy that compares cytogenetic mapping, genetic mapping and dna sequence

Solutions

Expert Solution

  • Sequencing refers to the determination of sequence of DNA, RNA or protein.
  • DNA sequencing helps in the knowledge of the genetic code, which will further determine the expressed products and their properties.
  • DNA sequence refers to arrangement of nucleotides.
  • Thus, DNA sequence may be compared to words made of chronological arrangement of alphabets (where alphabets are analogous to nucleotides).
  • Location of a gene in a chromosome is called its locus. The location of the gene determines its traits, evolutionary variations, mutations, recombination, linkages, and several other important aspects.

    Gene location on a chromosome may be determined by genetic mapping.

  • 1. Cytogenic mapping for gene location:

    In this method, the chromosome is stained, and bands are obtained, in form of dark and light bands and sub-bands. The location of the gene is indicated by the position of the band in relative to the centromere, and location of gene in short or long arm (p or q) arm of the chromosome. A number is used to designate the position on the autosome (1 to 22) or X and Y to represent sex chromosome.

    Example: If a gene location is indicated as 14p11, this indicates that the gene is on 14th autosomal chromosome on the p arm. Abbreviations may be used like: “cen”- if the gene is close to centromere, “ter”- if gene is near terminus, “tel” -indicating telomere.

    2. Molecular mapping for gene location.

    Molecular location is based on sequence or base pair of a gene. Molecular mapping may be either be in form of genetic map or physical map.

    A. Physical map helps in determining the actual location of the gene on the chromosome, measured in terms of gene distance as base pairs. It may use molecular tags Expressed tag sequence (ETS) or radio-hybrids or radio isotopes of nucleotides.

  • Thus, the genetic mapping is like finding a sentence with the words of interest.

  • While cytogenetic mapping is like the index refering to chapters.

The entire analogy is:

  • Nucleotides forming DNA sequence- alphabets forming words. Example thw word gene.

  • Genetic mapping- scanning for sentences with the word "gene".

  • Cytogenetic mapping: The chapters with the word and sentence with gene.


Related Solutions

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
Describe the evidence for the fact that DNA is the genetic material and the sequence of...
Describe the evidence for the fact that DNA is the genetic material and the sequence of events leading from the sequence of nucleotides of DNA to the sequence of amino acids in proteins and their secretion. Include in your answer: a. the early evidence for the location of genes on chromosomes, the first evidence that DNA was the genetic material, and that genes determined the structure of proteins b. a description of the mechanisms and structures involved in of transcription...
1) Is myelin continuously being made? 2) can you come up with a good analogy for...
1) Is myelin continuously being made? 2) can you come up with a good analogy for the time course of the action potential?
In genetic modifications, DNA inserted can come from _____ . only the same species as the...
In genetic modifications, DNA inserted can come from _____ . only the same species as the vector only the same plasmid as the vector only the same phylum as the plasmid vector any organism containing the DNA of interest only the same species as the host
What are the components/ steps of the genetic mapping in plants?
What are the components/ steps of the genetic mapping in plants?
A base-paired DNA sequence is one where A's line up with T's and G's line up...
A base-paired DNA sequence is one where A's line up with T's and G's line up with C's. For example: base-paired DNA sequence ATCGAT TAGCTA If A is not paired with T, T with A, G with C, or C with G, then the sequence is not base-paired. For example: not a base-paired DNA sequence ATCGAT TAGCAA not a base-paired DNA sequence ATCGAT TATCTA A base-paired sequence also needs both sides to have the same length. For example, not a...
A DNA sequence is. TACACCTTGGCGACGACT
A DNA sequence is. TACACCTTGGCGACGACT WHAT IS m RNA sequence is _______________________________ mutated sequence is TACACCTTGGGACGACT what is mRNA mutated. ____________________________________ What kind of mutation is this and what would be the result in terms of the amino acid sequence? (hint... use chart in notes
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
How can the concept of recombination frequency be used in genetic mapping?
How can the concept of recombination frequency be used in genetic mapping?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT