Question

In: Biology

The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is...

The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is cleaved).

You previously determined the size of the product amplified in the PCR. which is the region between the bold section

TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGT

TTCCCGATTTTA AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGG

GCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTC

CAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGAT

AAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTG

GCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTA

TCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTG

TGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTG

CCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGC

GTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGG

GTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAG

CTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGA

ATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTAC

AGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGC

CATCTTCTGCCTGGTATTCTGGGTGCTCAAGGGTTTGAGGCCTCGGGTCCCCAAAGGC

CTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCGGGCATGTGCTGACCCTG

GGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGTCCT

GCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCG

GCAGGCCCTG

Now, identify the ApaI site within this region. If you digest the PCR product with ApaI, how many fragments of DNA would you get, and what would be the sizes of the resulting DNA fragments (in base pairs)?

Solutions

Expert Solution

The PCR product is as with the ApaI shown in Green Bold:

GAGAGCGATGGGGAGGGCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTCCAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGATAAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTGGCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTATCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTGTGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTGCCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGCGTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAGCTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGAATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTACAGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGCCATCTTCTGCCTGGTATTCTGGGTGCTCAAGGG

The number of fragments formed are two as there is only one restriction site for ApaI in the PCR product.

Fragment I

It contains 493 Base Pairs

GAGAGCGATGGGGAGGGCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTCCAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGATAAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTGGCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTATCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTGTGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTGCCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGCGTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGCC

Fragment II

It contains 251 Base Pairs

CAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAGCTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGAATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTACAGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGCCATCTTCTGCCTGGTATTCTGGGTGCTCAAGGG

gladiator answered 1 year ago
Next > < Previous

Related Solutions

Which enzyme/s are used in recombinant DNA technology? ligase polymerase helicase restriction enzyme
Which enzyme/s are used in recombinant DNA technology? ligase polymerase helicase restriction enzyme
Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.
Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.
1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI...
1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI recognizes the sequence GGATCC. Digestion of a particular bacteriophage genome produced a total of 160 SauIIIA fragments. Approximately how many BamHI fragments would you expect if: A) the phage genome has a “G+C” content of 50%? B) the phage genome is 80% G+C? 2. At least some of the RNA sequences below include significant regions that are self-complementary, and therefore might form secondary structures...
1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI...
1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI recognizes the sequence GGATCC. Digestion of a particular bacteriophage genome produced a total of 160 SauIIIA fragments. Approximately how many BamHI fragments would you expect if: A) the phage genome has a “G+C” content of 50%? B) the phage genome is 80% G+C? 2. At least some of the RNA sequences below include significant regions that are self-complementary, and therefore might form secondary structures...
The AseI restriction enzyme recognizes the sequence ATTAAT. Which of the following prokaryotic genomes will on...
The AseI restriction enzyme recognizes the sequence ATTAAT. Which of the following prokaryotic genomes will on average yield thelargest fragments after cutting with this enzyme? a. The AseI enzyme will not cut prokaryotic DNA b. S. aureus (G+C content = 34%) c. E. coli (G+C content = 50%) d. Rhodobacter sphearoides (G+C content = 68%) e. The G+C content does not affect fragment size when the recognition sequence has no G or C bases.
The enzyme required for transcription is * RNA polymerase Restriction enzymes Splicesome DNA polymerase
The enzyme required for transcription is * RNA polymerase Restriction enzymes Splicesome DNA polymerase
The very useful restriction enzyme SpoBob hydrolyses the phosphodiester bond between the guanylates in the sequence...
The very useful restriction enzyme SpoBob hydrolyses the phosphodiester bond between the guanylates in the sequence AGGACCA. Is SpoBob generating blunt or sticky ends? Please explain.
The very useful restriction enzyme SpoBob hydrolyses the phosphodiester bond between the guanylates in the sequence...
The very useful restriction enzyme SpoBob hydrolyses the phosphodiester bond between the guanylates in the sequence AGGACCA. Is SpoBob generating blunt or sticky ends? Please explain. this is actually biochemistry
There are hundreds of different restriction enzymes, each of which cuts a specific target DNA sequence....
There are hundreds of different restriction enzymes, each of which cuts a specific target DNA sequence. a. What are the two types of cuts different restriction enzymes can make? b. In a cloning procedure, why would you use the same restriction enzyme to excise the target DNA sequence and to cut the plasmid? (1 mark) c. What enzyme would you use for the next step and what would it do?
You would like to sequence the genome of this organism. The restriction enzyme cut site for BglII is AGATCT.
  A) You would like to sequence the genome of this organism. The restriction enzyme cut site for BglII is AGATCT. You will use it to clone fragments of the genome in order to sequence it. How many times would you expect this enzyme to cut within the chromosome of Andrebacillus wieczorius ? (2) B) You decide to use a modified bacteriophage vector that can accommodate fragments digested with BglII. You use a partial digest on the chromosomal DNA. What...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT