Question

In: Biology

Explian in a simple paragraph how the genome project was sequenced? How is traditional DNA sequencing...

Explian in a simple paragraph how the genome project was sequenced?

How is traditional DNA sequencing performed? What sort of information is obtained from DNA sequencing? Explain in a paragragh.

Solutions

Expert Solution

Genome projects are scientific endeavours that ultimately aim to determine the complete genome sequence of an organism and to annotate protein-coding genes and other important genome encoded features.

The genome sequence of an organism includes the collective DNA sequence of each chromosome in the organism. For a bacterium containing a single chromosome , a genome project will aim to map the sequence of that chromosome. For human species, whose genome includes 22 pairs of autosomes and 2 sex chromosomes , a complete genome sequence will involve 46 saperate chromosomes sequences.

How is DNA sequencing performed

1. DNA sequencing involves the process of figuring out the precise order of the 4 bases found in one piece of DNA.

2. The DNA is really just a template that is used to create a series of fragments.

3. The fragments differ in length by one base and they are saperated by size before the bases are identified, which then effectively recreates the original DNA sequence.

4. Each person has 23 pairs of chromosomes one copy of the human genome.

5. Because technology has limitations, we are limited in how many bases can be readed at one time.

6.Therefore, we cant just read each base from one end of a chromosome to the other. To make it feasible, the chromosome is cut down into smaller fragments.

Applications

1.With its study we can understand the function of a specific sequence and the sequence responsible for any disease.

2. With the help of comparative DNA sequence study we can detect any mutation.

3. DNA fingerprinting.

4. By knowing the whole genome sequence , human genome project get completed.  


Related Solutions

How does Whole Genome Sequencing work? Why is Whole Genome Sequencing useful for tracking the spread...
How does Whole Genome Sequencing work? Why is Whole Genome Sequencing useful for tracking the spread of S. Aureus infections? What is a 'clone' of S. aureus? Which clone is most common in the US, Canada, and South America? What is an 'endemic' disease? What are 'reservoirs' of disease? Which reservoirs play the greatest role in spreading MRSA in households? What are some ways MRSA may be spread through the household? What was one method used to reduce the rate...
1. what is genome sequencing? what do we now know about the human genome from sequencing...
1. what is genome sequencing? what do we now know about the human genome from sequencing it? 2. explain different applications of genomics. What are SNPs is and how are they useful? 3. what are the uses of biotechnology in medicine?
1. In a paragraph, what are the major steps performed during next generation sequencing of DNA?...
1. In a paragraph, what are the major steps performed during next generation sequencing of DNA? How do these steps differ in the Illumina platform as compared to the Roche 454 platform? 2. In a paragraph, describe the major steps performed during DNA sequencing by the Pacific Biosciences, as well as the Oxford Nanopore Sequencing Technologies. 3. In a paragraph, describe the major advantages and disadvantages of each DNA sequencing platform.
How does high throughput sequencing differ from traditional sequencing methods? What makes high throughput sequencing faster...
How does high throughput sequencing differ from traditional sequencing methods? What makes high throughput sequencing faster and cheaper?
what is an exome ? why can exome sequencing be more informative than genome sequencing for...
what is an exome ? why can exome sequencing be more informative than genome sequencing for investigating the genetic basis of trait?
How can de DNA sequencing reveal a protein using Sanger dideoxy DNA
How can de DNA sequencing reveal a protein using Sanger dideoxy DNA
How are the DNA polymerases used in nature (DNA replication) and sequencing different? What other steps...
How are the DNA polymerases used in nature (DNA replication) and sequencing different? What other steps in DNA sequencing are different than prokaryotic DNA replication?
Explain how DNA synthesis is used for 3 different methods of base sequencing.
Explain how DNA synthesis is used for 3 different methods of base sequencing.
QUESTION #1 What was the pre-genome sequencing estimate for the total number of genes in the...
QUESTION #1 What was the pre-genome sequencing estimate for the total number of genes in the human genome and how many genes were discovered once sequencing was complete? Why do you think there was such a discrepancy between these numbers? QUESTION #2 Why is looking for regions of the genome that are very similar across organisms (conserved) such an important part of understanding genome evolution?
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC-3' Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5' - CCCTAGTTAAAAC-3' Fragment 4: 5' - ACCGCAATACCCTAGTT - 3' Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3' Fragment 6: 5' - ATTTACCGCAAT - 3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT