The following is a portion of the non-template DNA sequence from the human ras gene. Answer...

The following is a portion of the non-template DNA sequence from the human ras gene. Answer the following questions about this gene and the effects of gene changes to the specified mutant sequence (mutation in BOLD).

Normal human ras: 5’-acatgactgaatataaacttgtggtagttggagctggt-3’

Mutant human ras: 5’-acatgactgaacataaacttgtggtagttggagctggt-3’

a. (4) What is the normal human Ras amino acid sequence from this portion of the gene, starting with the first start codon?

b. (2) Which amino acid from the normal sequence is mutated, and what is the amino acid changed to in the mutant sequence?

c. (3) What type of mutation is present in this gene (nonsense, missense, silent, transition, transversion)? Include all of the listed terms that apply.

d. (1) Is ras a proto-oncogene or a tumor suppressor gene?

e. (3) Describe the normal cellular function of Ras. How might a mutation in ras promote cancer formation, based on this normal cellular function described in your textbook?

Expert Solution

a.mRNA seq: UGU ACU GAC UUA UAU UUG AAC ACC AUC AAC CUC GAC CA

Ptn seq : CYS THR ASP LEU TYR LEU ASN THR ILE ASN LEU ASP CA

b.Mutated Ptn: CYS THR ASP LEU TYR LEU ASN THR ILE ASN LEU ASP CA (AAT - AAC -----> Leucine) (T --->C pyrimidine to pyrimidine transition)

c. Silent Mutation: since there is no change in the amino acid change in the 2nd protein sequence

d. Ras is a proto - oncogene.

e.

gladiator answered 1 year ago

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG...

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG TTA TGG CTG CTT – 3’ 1. Provide sequence of template DNA 2. Provide sequence of mRNA 3. Provide sequence of tRNA anticodon for the 3rd triplet 4. Provide the sequence of the amino acid encoded by the mRNA 5. What is the effect on the amino acid sequence as a result of each of the following mutations? substitution of T for G at...

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC...

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC CGA ACT-5′ nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #7, what is the amino acid sequence? d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e. If there is a transversion at nucleotide #6, what...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 1 ATGAGGAGTT 11 GACACACAAG 21 AGGAGGTAGC 31 AGTATGGGTA 41 TAATCTAATG 51 CGTAATTGAG 61 GAGGTAGTTG 71 ACGTATGAAT 81 AGTTAACGTA 91 CGGGGGGGAA 101 ACCCCCCCTT 111 TTTTTTTTTC 121 GAGCAATAAA 131 AGGGTTACAG 141 ATTGCATGCT b) What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-131 71-119 74-149 54-119 c) What will the sequence be for the protein translated from this mRNA? d) Where...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) •...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) • Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence. • Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence. 5’ 3’ GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC 3’ 5’ CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): 5’-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3’ Consider the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA that you determined in the previous question. What is the amino acid sequence of the polypeptide encoded by this mRNA? You must show and explain all work/evidence to receive credit.

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would...

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would occur in the daughter strand of the altered strand? a. 3' ACTA 5' b. 3' ACTAA 5' c. 3' ACTAG 5' d. 3' AAG 5'

If the DNA sequence in the question above is at the BEGINNING of a gene, what...

If the DNA sequence in the question above is at the BEGINNING of a gene, what are the first 2 amino acids that will be joined at the ribosome? Remember there is a START codon. Use the information on this chart to answer the question. asparagine, alanine methionine, glutamine leucine, alanine alanine, lysine methionine, asparagine

Q.N.2) A portion of a specicific DNA molecule consists of the following sequence of nucleotide triplets:...

Q.N.2) A portion of a specicific DNA molecule consists of the following sequence of nucleotide triplets: TAC GAA CTT CGG What is the DNA sequence codes for this terapeptide?

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Question