In: Biology
2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2)
• Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence.
• Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence.
5’ 3’
GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC
3’ 5’
CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG
1) The recognition site for EcoR1 is GAATTC, and it cuts between G and A. On the complementary strand, it cuts between A and G leaving 4 unpaired bases (AATT) on one strand. These unpaired bases form the sticky end since they have ability to stick to a complementary single-stranded DNA or any other complementary overhang. Hence, in the sequence given above the bases between which EcoR1 will cut are as given in bold and underlined below:
5’-G AATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC-3'
3’-CTTAA GTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG-5'
2) The recognition site for BamH1 is GGATCC and the cleavage occurs between G and G. On the complementary strand, cleavage occurs between G and G leaving a 4 base pair unmatched overhang (GATC). This overhang forms the sticky end for pairing with another complementary single stranded DNA or any other sticky end with complementary base sequence. In the sequence given above the bases between which EcoR1 will cut are as given in bold and underlined below:
5’-GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAG GATCC-3'
3’-CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAG G-5'