What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...

What is the mRNA sequence of the following original DNA sequences?

a) TAC

b) GAG

c) CAT

d) AAA

e) GCC

f) TTC

g) CCG

h) TGT

Expert Solution

Please go through the following points before deciding the mRNA sequence from the original DNA sequences given in the question. After going through the points, you will be able to find out the mRNA sequence and solve other similar questions.

Guanine (G) and cytosine (C) are complementary to each other. So, guanine (G) in the original DNA sequence will be replaced by cytosine (C) in the mRNA sequence. Similarly, cytosine (C) in the original DNA sequence will be replaced by guanine (G) in the mRNA sequence.

Thymine (T) and adenine (A) are complementary to each other. So, thymine (T) in the original DNA sequence will be replaced by adenine (A) in the mRNA sequence. Adenine (A) in the original DNA sequence will be replaced by uracil (U) in the mRNA sequence due to the absence of thymine (T) in the mRNA.

The mRNA sequences of the original DNA sequence are given in the following table.

Original DNA sequences	mRNA sequences
TAC	AUG
GAG	CUC
CAT	GUA
AAA	UUU
GCC	CGG
TTC	AAG
CCG	GGC
TGT	ACA

gladiator answered 2 years ago

Which of the following pairs of mRNA sequences is translated to the same protein sequence ?...

Which of the following pairs of mRNA sequences is translated to the same protein sequence ? Answer UUA UAU CGU CGG CUU UAC AGA AGG Using UCSC genome browser, find out the name of the human gene which is located within the genomic region chr21:38,785,658-38,844,604 of hg38 human genome version ? Answer: ETS2 I know the answer but I dont know how to solve them can you show me how to solve them please step by step its for bioinformatics

Use the mRNA codon chart to translate this DNA message: DNA TAC TGC ...

Use the mRNA codon chart to translate this DNA message: DNA TAC TGC CAC ATT mRNA amino acid List the sequence of amino acids in this chain Suppose the sixth base in the DNA chain was an A instead of a C. How would this affect the protein produced? What is the name given to this type of mutation in a protein chain? Explain Which of the following bird species are most closely related? ...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of...

3’ - TAC AAA GAG GAT CCG ACC TCA ACT - 5” 3. The DNA template...

3’ - TAC AAA GAG GAT CCG ACC TCA ACT - 5” 3. The DNA template for transcription is only one strand of the DNA double helix. How do we know that the mRNA is not based on the sequence of the other DNA strand? 4. What is the anticodon sequence of the tRNA that binds to the fourth codon of this mRNA? 5. Translate the mRNA sequence into the amino acid sequence (use the genetic code table from the...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

If you wanted to measure expression of DNA at the level of specific transcribed mRNA sequences,...

If you wanted to measure expression of DNA at the level of specific transcribed mRNA sequences, what method could you use? (Describe quantitative reverse-transcription PCR (qRT-PCR).)

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC...

The following sequence represents the DNA template strand of a gene. 3′-TAC TGT GTC TCC CAC CGA ACT-5′ nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #7, what is the amino acid sequence? d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e. If there is a transversion at nucleotide #6, what...

In sequences and series what is a sequence and what is a series? Mention some types of sequences?

Question