Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Expert Solution

gladiator answered 1 year ago

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT a. Which strand of DNA is transcribed and in which direction? Support your response by indicating the 5 amino acid sequence that results when this transcript is translated. (2 pts) b. Label the 5’ and the 3’...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues and 14,000 G+C residues. Analysis of one of the strands of DNA showed that it had 3,000 A and 4,000 C residues. What is the number of T and G base residues on this strand?

(20 pts total) You are determining the Tm (melting temperature) for the double stranded DNA molecule...

(20 pts total) You are determining the Tm (melting temperature) for the double stranded DNA molecule created by hybridization of 2 oligonucleotides with the following sequences: O1 : 5’-d-GCTTGATTAGTTATTGC-3’ O2 : 5’-d-GGGGCAATAACTAATCAAGC-3’ a. (5 pts) Write down the sequence of the hybridized/annealed double stranded DNA molecule. Make sure the sequences are aligned, as they would be in the resulting DNA molecule. Label the 5’ and 3’ end of each strand. O1/O2 5'-d-GCTTGATTAGTTATTGC-3' 3'-CGAACTAATCAATAACGGGG-d-5' b. (7 pts) You want to label...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield...

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound such as RNA polymerase. Why is this method done in the absence of ribonucleotide triphosphates?

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,...

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). 5’ AGATCGGATCGTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 3’ Identify the DNA sequence that encodes each peptide Determine the amino acid sequence of each peptide In a mutant viral strain, the T at position 23 has been replaced with a...

when performing PCR (polymerase chain reaction), how is the double stranded DNA split into two single...

when performing PCR (polymerase chain reaction), how is the double stranded DNA split into two single stranded DNA molecules? a) high temperatures b) the action of helicase c)the action of dna polymerase d) the action of Taq polymerase

Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping,...

Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping, the addition of new nucleotides, and the products of replication.

Question