DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield...

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound such as RNA polymerase. Why is this method done in the absence of ribonucleotide triphosphates?

Expert Solution

Ans. - DNA footprinting is a technique where the double stranded DNA is cut by the enzymes endonucleases in between, so these form short nucleotides then, But these enzymes can only act if no other proteins are attached on DNA hence polymerase being present means the process of transcription is to occur.

so DNA footprinting is for identifying DNA-protein binding sites, RNA polymerase adds ribonucleotides for transcription which will affect its process of identification.

DNA footprinting is a method of investigating the sequence specificity of DNA-binding proteins in vitro.

This technique can be used to study protein-DNA interactions both outside and within cells. Basic RNA-binding peptides enhance ribozyme catalysis.

These enzymes mediate viral and cellular replication and antiviral defense in eukaryotes and prokaryotes, splicing, R-loop resolvation, DNA repair.

If you have any doubt then mention in comment.

gladiator answered 2 years ago

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT a. Which strand of DNA is transcribed and in which direction? Support your response by indicating the 5 amino acid sequence that results when this transcript is translated. (2 pts) b. Label the 5’ and the 3’...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues...

A double stranded DNA molecule was found to have a total of 10,000 A+T base residues and 14,000 G+C residues. Analysis of one of the strands of DNA showed that it had 3,000 A and 4,000 C residues. What is the number of T and G base residues on this strand?

You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...

You have a piece of double stranded DNA that is 300 base pairs and 50% guanine 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group...

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group to select cytosine bases in the DNA C) Is inhibited by decitabine D) All of the above E) None of the above Angelman Syndrome and Prader Willi Syndrome revealed that a similar chromosomal deletion could manifest as two very different (phenotypically distinct) syndromes. The genetic basis for the difference: Arises from changes in transcription due to promoter swapping at the deletion site. Depended on...

Herpes and adenoviruses are both viruses with linear double stranded DNA-gemones, but their replication mechanism differ...

Herpes and adenoviruses are both viruses with linear double stranded DNA-gemones, but their replication mechanism differ considerably. Give step by step-summaries of both mechanisms (you may use drawings). Note. the question refers to replication mechanism and not life cycle.

Question