( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing

1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method.

2) Name three changes that you could make to decrease your ecological footprint.

3) What can we do to preserve and restore biodiversity?

4) What can we do to limit climate change?

5) Just for fun, I saw this article pop up on social media a few months ago. I thought it was interesting and related to the material. Tell me what you think.

Solutions

Expert Solution

Complimentarity property in DNA

DNA as the genetic material

Evolution of DNA from RNA

DNA is a double stranded structure. The double helix model of the DNA is established by the Watson and Crick. DNA is made up of four types of nucleotides . Adenine guanine cytosine and thymine. The DNA dependent DNA polymerase replication of DNA in 5 prime to 3 prime direction. the DNA molecule shows the property of complementarity that means if the nucleotide sequence of one strand is known then the sequence of the other strand is complementarity to the other strand. The DNA differs from the RNA molecule is that the DNA has the deoxyribo nucleic acid sugar and the RNA has ribonucleic acid sugar . The RNA has Uracil in place of cytosine .the DNA is converted into RNA and DNA further converted into protein this process is known as the central dogma model. The process of DNA replication occur in two strands. The lagging and leading strand. the lagging strand is formed by many strands known as a okazaki fragments .adenine is complementarity to the thymine and the Guanine is complementarity with cytosine . In the case of RNA thymine is replaced by uracil. The DNA has 10 base pair in each turn .

Thanking you

Have a beautiful day ?✨✨

Please ,Hit a Thumbs up ??

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Describe the 3 structures the DNA double helix could exist in.

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield...

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound such as RNA polymerase. Why is this method done in the absence of ribonucleotide triphosphates?

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group...

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group to select cytosine bases in the DNA C) Is inhibited by decitabine D) All of the above E) None of the above Angelman Syndrome and Prader Willi Syndrome revealed that a similar chromosomal deletion could manifest as two very different (phenotypically distinct) syndromes. The genetic basis for the difference: Arises from changes in transcription due to promoter swapping at the deletion site. Depended on...

The term "double helix" as it is used to describe DNA refers to the the fact...

The term "double helix" as it is used to describe DNA refers to the the fact that DNA is comprised of 2 DNA strands that are twisted together to form a spiral. True False The genotype ratio compares the number of times each genotype would be produced in the offspring of a mating. True False If one strand of a segment of DNA has a base sequence of A-G-C-A-T, its complementary strand would be T-C-G-T-A. True False t RNA: carries...

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed...

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed including the Base Pairing rules and the Antiparallel structure.

The enzyme that unwinds the DNA double helix is called DNA gyrase c. helicase primase

The enzyme that unwinds the DNA double helix is called DNA gyrase c. helicase primase d. ligase RNA polymerase has 5’- 3’ exonucleases 3’- 5’ exonucleases both exonucleases no exonucleases In the synthesis of RNA the addition proceeds by attack of the 3’OH to the a phosphate of the incoming NTP attack of the 3’OH to the a phosphate of the incoming dNTP attack of the 5’OH to the a phosphate of the incoming NTP attack of...

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA

Question 30: A. Describe the secondary structural characteristics of B-form double-stranded DNA. B. Explain how to...

Question 30: A. Describe the secondary structural characteristics of B-form double-stranded DNA. B. Explain how to determine the number of supercoils present in a molecule of DNA. C. Explain/demonstrate how to determine changes in linking number for DNA.

Subjects