A) The +1 start of transcription is at position 52 of the following sequence. If the...

A) The +1 start of transcription is at position 52 of the following sequence. If the top strand is the coding strand, and the bottom strand is the template strand, write out the transcribed RNA sequence.

5' TACCGAGAGAGGTTGACAAATGCCTAGATTGATGATTATA 3'
3' ATGGCTCTCTCCAACTGTTTACGGATCTAACTACTAATAT 5'
   0000000001111111111122222222233333333334
   1234567890123456789012345678901234567890


5' TAATTCGGATGAGAGGGTTCAGGACAAGCTTTAGCCCTAT 3'
3' ATTAAGCCTACTCTCCCAAGTCCTGTTCGAAATCGGGATA 5'
   4444444445555555555666666666677777777778
   1234567890123456789012345678901234567890


(Write the sequence of nucleotides from the start site to the end without spaces or any other characters, just a string of RNA nucleotides)

Solutions

Expert Solution

The transcription initiation site on a DNA strand is referred to as the +1 position.

Acoording to the given data the +1 site is at the 52nd position of the following sequence as marked below:

5' TACCGAGAGAGGTTGACAAATGCCTAGATTGATGATTATA 3' 3' ATGGCTCTCTCCAACTGTTTACGGATCTAACTACTAATAT 5' 0000000001111111111122222222233333333334 1234567890123456789012345678901234567890 5' TAATTCGGATGAGAGGGTTCAGGACAAGCTTTAGCCCTAT3'

3' ATTAAGCCTACTCTCCCAAGTCCTGTTCGAAATCGGGATA 5' 4444444445555555555666666666677777777778 1234567890123456789012345678901234567890

Therefore the transcribed RNA sequence from the bottom template strand of the DNA would be synthesized in the 5' to 3' direction from the +1 transcription site as:

5'

 AGAGGGUUCAGGACAAGCUUUAGCCCUAU

3'

gladiator answered 1 year ago

Next > < Previous

Related Solutions

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start...

The following sequence is a portion of a eukaryotic promoter. The +1 coordinate (the transcription start site) is indicated as the red/bold “g”. cggctcaataaaataacaggagtctataaaagcgtggggacagttcaggagggggctcgc TBP binds a cis-acting element within this sequence. What is the coordinate of the 5’ deoxynucleotide of this cis-acting element?

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

1. Which DNA sequence is recognized first to initiate transcription in eukaryotes? A. TATA box B....

1. Which DNA sequence is recognized first to initiate transcription in eukaryotes? A. TATA box B. poly A sequence C. coding sequence D. enhancer 2. Strand initiation in DNA replication is accomplished when the enzyme primase lays down a primer. In prokaryotes, of what molecule is that primer composed? A. DNA B. RNA C. protein D. lipid

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?

The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme

A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding...

A. Draw a typical bacterialgene. Be sure to includeand labelthe promoter, transcription start site, transcription terminator,coding region, and untranslated regions. Below the gene draw a full-length mRNA transcript of the gene. On the mRNA, label the 5’ & 3’ ends, the coding region, and the UTRs. B. Draw a typical eukaryotic gene. Be sure to includeand labelthe core promoter, some proximal promoterelements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw...

Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site....

Eukaryotic transcription factors often bind to DNA at sites long distances from the transcription start site. These DNA regions are called:

What is the difference between a start-transfer sequence and a signal sequence What does a signal...

What is the difference between a start-transfer sequence and a signal sequence What does a signal peptidase do? What happens to a signal sequence after it’s cleaved? What does it mean when the translocator is gated in two directions?

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

Consider a secure communication channel where communication will start if the receiver detects the following sequence:...

Consider a secure communication channel where communication will start if the receiver detects the following sequence: A=1, B=0 --> A=0, B=0 --> A=0, B=1 Draw a FSM state diagram with 2 inputs, first input (A), and second input (B), 1 output signal: correct sequence (Seq_detected). Create a Verilog code for this FSM and use the testbench to verify its correct operation. Even just a state diagram would help. Thanks

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...

Subjects