Question

In: Computer Science

Your supervisor has asked to be informed of your activities and accomplishments and any problems you...

Your supervisor has asked to be informed of your activities and accomplishments and any problems you are encountering.

Your Task

For a job or volunteer position that you currently hold, or a previous one, describe your regular activities, discuss irregular events that management should be aware of, and highlight any special needs or problems you are having. Address the report to your supervisor, and include the company or organization's name and location.

Language Requirements

  • 200-300 words
  • General language: no slang or formal
  • Positive, respectful, and professional language
  • Proofread and correct all grammar and spelling errors before submitting (use Grammarly and your own eyes)

Format Requirements

  • Memo format informal report, in block style
  • From, To, Date, and Subject fields
  • Different sections with titled headings (example: Introduction, Activities, Events, Problems)
  • One or more number lists or bullet lists (this list is an example)
  • MS Word or Mac Pages file format
  • Submitted via Schoology assignment link by 8:00pm (3 hours before 11:00pm deadline)

Solutions

Expert Solution

DATE : October 12th, 2020

FROM: M. John Steve

Student Coordinator,

Heal to the Core,

Delhi, India.

TO: J. Michael Velayudham

   Supervisor,

Heal to the Core,

Delhi, India.

SUBJECT: Updates of activities, accomplishments and problems by Student Coordinator.

INTRODUCTION:

The culture of volunteering or community service at the time of the Student’s graduation period has become extinct nowadays. In order to explore the importance of volunteer work at our teenage level to become a good citizen, we have initiated a few activities in our company/organization. To understand and explore how a people’ Initiative turned out into a Community Service organization with remarkable voluntary activities changing people’s lives is our primary goal. And to get more insights into how an NGO prepares their own rules and regulations maintaining a sustainable organization. The Executive Committee Members responsible for overseeing each and every task of the organization. These committee members possess very good interpersonal skills along with strong decision-making skills. They can manage and take situation-centric decisions which are very crucial for avoiding any miscommunication to the other people. I have visited their office in the administrative Block. I have observed how the files and records are being maintained in a well-structured organization. Every case they deal with has a proper cause that can really inspire people to raise funds and donate to that cause.

ACTIVITIES:

  • Providing daily needs to the people to meet the minimum requirements in the campus, traveling allowances on vacation, and providing tricycles and washing machines to the differently-abled people.
  • Providing financial support for the medical needs and surgeries of the people.
  • In continuation of its endeavor towards service and to bring health awareness among people, conducting Mega health camps, eye camps in the campus for the welfare of people.
  • Organizing blood donation camps inside the campus in collaboration with other community-level organizations/clubs.
  • Deliveing the best services to the needy sections of communities like organizing cloth donation campaigns, student visits to old-age homes and orphan child homes, donations to relief funds on natural calamities, and many more.

PROBLEMS:

  • The information is not being circulated to the root level volunteers which causes many problems like inactive for students, less donations etc.
  • Activities are not being promoted in all social media platforms.
  • Frequent information and productive meetings aren't happening in most of the times.

Related Solutions

In your first assignment on the job, your supervisor has asked you to report on the...
In your first assignment on the job, your supervisor has asked you to report on the company’s competitors future products. You really want to succeed. What do you do? A. You could call the competitors pretending you are a college student working on project needing information B. You could ask a college friend to call the competitors and ask for the information C. You could call the competitors, but would not tell them who you really are unless if asked...
Your supervisor has asked you to explain the value of the fact that you completed this...
Your supervisor has asked you to explain the value of the fact that you completed this accounting course.
Assume that you are a manager in a factory and your supervisor has asked you increase...
Assume that you are a manager in a factory and your supervisor has asked you increase productivity without hiring additional workers or incurring overtime. Describe how you could motivate the existing workers using one content perspective and one process perspective. Support your answer.
As a member of the Finance Department of Ranch​ Manufacturing, your supervisor has asked you to...
As a member of the Finance Department of Ranch​ Manufacturing, your supervisor has asked you to compute the appropriate discount rate to use when evaluating the purchase of new packaging equipment for the plant. Under the assumption that the​ firm's present capital structure reflects the appropriate mix of capital sources for the​ firm, you have determined the market value of the​ firm's capital structure as​ follows: To finance the​ purchase, Ranch Manufacturing will sell 10​-year bonds paying interest at a...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Imagine that you work for a state health department. Your supervisor has asked that you review...
Imagine that you work for a state health department. Your supervisor has asked that you review vaccines for an upcoming training session for public health professionals. You will present this information in a professional report. For this report, you will select a vaccine-preventable disease or biological agent and describe the characteristics of a homeostatic system in both health and in a diseased state. Your report should include the pathophysiological impact on the body system affected in disease, how the disease...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V...
Your supervisor asked you to design a diode that has a total junction capacitance at 0V of 1pF. You are asked to start with an n-type GaAs wafer with a doping of 1x1017 cm-3, then create the p-type layer by doping the substrate with accepters. The substrate manufacturer told you that the GaAs substrate has trap centers equal to 2x1014 cm-3 and capture cross-sections for electrons and holes was of 1.0x10-12 cm2. After designing the diode, you are asked to...
Your supervisor has asked you to prepare some calculations based on the company’s data and then...
Your supervisor has asked you to prepare some calculations based on the company’s data and then research publicly available similar competitor information to see how your company is performing within the industry. Your company, CarryIt Inc., produces mass quantity, inexpensive tote bags for promotional marketing purposes, which is a very competitive business. Here is the available data for your company: Labor hours .25; Labor rate $11.75/hour; Materials input .5 yds. fabric; Materials price $1.50/yd.; and Variable overhead rate of $5.00...
Your supervisor has asked you to evaluate the relative attractiveness of the stocks of two very...
Your supervisor has asked you to evaluate the relative attractiveness of the stocks of two very similar chemical companies. Litchfield Chemical Corp. (LCC) and Aminochem Company (AOC). Both firms have a June 30 fiscal year end. You have compiled the data in Table 1 for this purpose. Use a 1-year time horizon and assume the following: Real gross domestic product is expected to rise 5%; S&P 500 expected total return of 20%; U.S. Treasury bills yield 5%; and 30 year...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT