Question

In: Biology

Given the two sequences below, there are five possible DNA alignments involving different placements of a...

Given the two sequences below, there are five possible DNA alignments involving different placements of a gap. Find the optimal alignment(s) given that the gap penalty is 3, the cost of a transition mismatch = 1, and the cost of a transversion mismatch = 2. Show all alignment scores used to generate your answer. b) Why is it important to carefully align sequences for phylogenetic analysis? (Sequence 1 = TCGTASequence 2 = TTCA

Solutions

Expert Solution

gladiator answered 2 years ago
Next > < Previous

Related Solutions

Below are the DNA sequences that encode the first eight amino acids for five alleles of...
Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosphila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. The fourth sequence shown above has...
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...
Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of...
To avoid the loss of terminal sequences different organisms use different strategies to replicate their DNA....
To avoid the loss of terminal sequences different organisms use different strategies to replicate their DNA. What strategy do prokaryotes use to replicate linear chromosomes to circumvent this problem? Provide a detailed answer.
To avoid the loss of terminal sequences different organisms use different strategies to replicate their DNA....
To avoid the loss of terminal sequences different organisms use different strategies to replicate their DNA. A. What features of the chromosome does E. coli have to circumvent this problem? Provide a detailed answer. B. What strategy do prokaryotes use to replicate linear chromosomes to circumvent this problem? Provide a detailed answer. C. What strategy do eukaryote use to replicate chromosomes to circumvent this problem? Provide a detailed answer.
Three peptides were obtained from a trypsin digestion of two different polypeptides. Indicate the possible sequences...
Three peptides were obtained from a trypsin digestion of two different polypeptides. Indicate the possible sequences from the given data. 1. Glu-Ala-Phe 2. Val-Val-Arg 3. Val-Met-Lys
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
A) Describe the differences between expressed sequences and not expressed DNA sequences and how to study...
A) Describe the differences between expressed sequences and not expressed DNA sequences and how to study them. For example, cDNA vs genomic libraries and RT PCR vs PCR- B) Restriction cutting DNA, running gels, and ligating DNA to make recombinant DNA. C) Difference between southern, northern, and western blotting. Describe what each is looking for?
Which method is more truthful for DNA sequences?
Which method is more truthful for DNA sequences?      
Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA...
Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA have? Explain where they are. Which one can be used and how do you know? 5'-AGTCGA TCGAACGGTCA TCG-3' 3'-TCAGCTAGCTTGCCAGTAGC-5' What feature of eukaryotes makes annotation more difficult? Describe the process whereby DNA is transferred from Agrobacterium to plants.
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT