Question

1. Given the following prokaryote sequence of DNA:
   
   Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)
   
   Predict the mRNA sequence that would arise from this DNA sequence.
   
   Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).
   
   Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).
   
   Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)
   
   5’TAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGCCCCCCAATGCTTTTTGTCGACTTCGACTTTAAATGCTCAAAAGGAGGCAAATGAAAACTT 3’

Answer 1

5’TAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGCCCCCCAATGCTTTTTGTCGACTTCGACTTTAAATGCTCAAAAGGAGGCAAATGAAAACTT 3’

The regions highlighted in green indicates the promoter sequences at -10 position (Green) and -35 position (Orange).

Translation starts at +1 position (Red), therefore mRNA will be:

5'- UUAAAGCGGAGGCAAAUUUGCCCCCCAAUG CUUUUUGUCGACUUCGACUUUAAAUGCUCAAAAGGAGGC AAAUGAAAACUU -3’

AUG is the start codon and UGA is the stop codon, The Purine rich sequence in purple represents the ribosome binding site.

polypeptide: N- Met-Leu-Phe-Val-Asp-Phe-Asp-Phe-Lys-Cys-Ser-Lys-Gly-Gly-Lys - C

Based on the nature of amino acids, The first 4 aminoacids are hydrophobic, Aspartic acid is negatively charged (polar), Lysine is positively charged (polar), Serine is uncharged (polar). based on the overall composition, The peptide is positively charged with many hydrophobic residues.